SSB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52329-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SSB Reagents
CRO Services
Product recommended

All SSB Reagents
SSB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Mouse Sjogren syndrome antigen B with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SSB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
SS-B cDNA ORF Clone, Mouse
SSB Background Information
Full Name
Sjogren syndrome antigen B

SSB cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
SSB cDNA ORF Clone in Cloning Vector, Cynomolgus CG90632-G
SSB cDNA ORF Clone, Cynomolgus, untagged CG90632-UT
SSB cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90632-ACG
SSB Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90632-ACGLN
SSB cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90632-ANG
SSB cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90632-ACR
SSB cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90632-ANR
SSB cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90632-CF
SSB cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90632-NF
SSB cDNA ORF Clone, Cynomolgus, C-His tag CG90632-CH
SSB cDNA ORF Clone, Cynomolgus, N-His tag CG90632-NH
SSB cDNA ORF Clone, Cynomolgus, C-HA tag CG90632-CY
SSB cDNA ORF Clone, Cynomolgus, N-HA tag CG90632-NY
SSB cDNA ORF Clone, Cynomolgus, C-Myc tag CG90632-CM
SSB cDNA ORF Clone, Cynomolgus, N-Myc tag CG90632-NM

SSB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SSB cDNA ORF Clone in Cloning Vector, Rat RG84789-U
SSB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84789-ACGLN

SSB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SSB cDNA ORF Clone in Cloning Vector, Mouse MG52329-G
SSB cDNA ORF Clone, Mouse, untagged MG52329-UT
SSB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52329-ACG
SSB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52329-ACGLN
SSB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52329-ANG
SSB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52329-ACR
SSB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52329-ANR
SSB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52329-NF
SSB cDNA ORF Clone, Mouse, C-His tag MG52329-CH
SSB cDNA ORF Clone, Mouse, N-His tag MG52329-NH
SSB cDNA ORF Clone, Mouse, C-HA tag MG52329-CY
SSB cDNA ORF Clone, Mouse, N-HA tag MG52329-NY
SSB cDNA ORF Clone, Mouse, C-Myc tag MG52329-CM
SSB cDNA ORF Clone, Mouse, N-Myc tag MG52329-NM
SSB qPCR Primer Pairs, Mouse MP202202

SSB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SSB cDNA ORF Clone in Cloning Vector, Human HG16933-U
SSB cDNA ORF Clone, Human, untagged HG16933-UT
SSB cDNA ORF Clone, Human, C-GFPSpark® tag HG16933-ACG
SSB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16933-ACGLN
SSB cDNA ORF Clone, Human, N-GFPSpark® tag HG16933-ANG
SSB cDNA ORF Clone, Human, C-OFPSpark® tag HG16933-ACR
SSB cDNA ORF Clone, Human, N-OFPSpark® tag HG16933-ANR
SSB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16933-CF
SSB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16933-NF
SSB cDNA ORF Clone, Human, C-His tag HG16933-CH
SSB cDNA ORF Clone, Human, N-His tag HG16933-NH
SSB cDNA ORF Clone, Human, C-HA tag HG16933-CY
SSB cDNA ORF Clone, Human, N-HA tag HG16933-NY
SSB cDNA ORF Clone, Human, C-Myc tag HG16933-CM
SSB cDNA ORF Clone, Human, N-Myc tag HG16933-NM
info info
添加购物车成功! 添加购物车失败!