SRSF5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51680-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SRSF5 Reagents
CRO Services
Product recommended

All SRSF5 Reagents
SRSF5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
375 bp
Description
Full length Clone DNA of Mouse serine/arginine-rich splicing factor 5
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRSF5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Sfrs5 cDNA ORF Clone, Mouse
SRSF5 Background Information
Full Name
serine/arginine-rich splicing factor 5

SRSF5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SRSF5 cDNA ORF Clone in Cloning Vector, Rat RG85300-U
SRSF5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85300-ACGLN

SRSF5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRSF5 cDNA ORF Clone in Cloning Vector, Mouse MG51680-U
SRSF5 cDNA ORF Clone, Mouse, untagged MG51680-UT
SRSF5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51680-ACGLN
SRSF5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51680-ACG
SRSF5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51680-ANG
SRSF5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51680-ACR
SRSF5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51680-ANR
SRSF5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51680-NF
SRSF5 cDNA ORF Clone, Mouse, C-His tag MG51680-CH
SRSF5 cDNA ORF Clone, Mouse, N-His tag MG51680-NH
SRSF5 cDNA ORF Clone, Mouse, C-HA tag MG51680-CY
SRSF5 cDNA ORF Clone, Mouse, N-HA tag MG51680-NY
SRSF5 cDNA ORF Clone, Mouse, C-Myc tag MG51680-CM
SRSF5 cDNA ORF Clone, Mouse, N-Myc tag MG51680-NM
SRSF5 qPCR Primer Pairs, Mouse MP201553

SRSF5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRSF5 cDNA ORF Clone in Cloning Vector, Human HG16418-G
SRSF5 cDNA ORF Clone, Human, untagged HG16418-UT
SRSF5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16418-ACGLN
SRSF5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16418-ACG
SRSF5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16418-ANG
SRSF5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16418-ACR
SRSF5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16418-ANR
SRSF5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16418-CF
SRSF5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16418-NF
SRSF5 cDNA ORF Clone, Human, C-His tag HG16418-CH
SRSF5 cDNA ORF Clone, Human, N-His tag HG16418-NH
SRSF5 cDNA ORF Clone, Human, C-HA tag HG16418-CY
SRSF5 cDNA ORF Clone, Human, N-HA tag HG16418-NY
SRSF5 cDNA ORF Clone, Human, C-Myc tag HG16418-CM
SRSF5 cDNA ORF Clone, Human, N-Myc tag HG16418-NM
SRSF5 qPCR Primer Pairs, Human HP105167
info info
添加购物车成功! 添加购物车失败!