SRPR cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG53026-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SRPR Reagents
CRO Services
Product recommended

All SRPR Reagents
SRPR cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1911 bp
Description
Full length Clone DNA of Mouse signal recognition particle receptor ('docking protein') with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRPR cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1300011P19Rik cDNA ORF Clone, Mouse;D11Mgi27 cDNA ORF Clone, Mouse
SRPR Background Information
Full Name
signal recognition particle receptor (docking protein)

SRPR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRPR cDNA ORF Clone in Cloning Vector, Mouse MG53026-G
SRPR cDNA ORF Clone, Mouse, untagged MG53026-UT
SRPR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53026-ACGLN
SRPR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53026-ACG
SRPR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53026-ANG
SRPR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53026-ACR
SRPR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53026-ANR
SRPR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53026-CF
SRPR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53026-NF
SRPR cDNA ORF Clone, Mouse, C-His tag MG53026-CH
SRPR cDNA ORF Clone, Mouse, N-His tag MG53026-NH
SRPR cDNA ORF Clone, Mouse, C-HA tag MG53026-CY
SRPR cDNA ORF Clone, Mouse, N-HA tag MG53026-NY
SRPR cDNA ORF Clone, Mouse, N-Myc tag MG53026-NM

SRPR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRPR cDNA ORF Clone in Cloning Vector, Human HG15140-G
SRPR cDNA ORF Clone, Human, untagged HG15140-UT
SRPR cDNA ORF Clone, Human, C-GFPSpark® tag HG15140-ACG
SRPR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15140-ACGLN
SRPR cDNA ORF Clone, Human, N-GFPSpark® tag HG15140-ANG
SRPR cDNA ORF Clone, Human, C-OFPSpark® tag HG15140-ACR
SRPR cDNA ORF Clone, Human, N-OFPSpark® tag HG15140-ANR
SRPR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15140-CF
SRPR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15140-NF
SRPR cDNA ORF Clone, Human, C-His tag HG15140-CH
SRPR cDNA ORF Clone, Human, N-His tag HG15140-NH
SRPR cDNA ORF Clone, Human, C-HA tag HG15140-CY
SRPR cDNA ORF Clone, Human, N-HA tag HG15140-NY
SRPR cDNA ORF Clone, Human, C-Myc tag HG15140-CM
SRPR cDNA ORF Clone, Human, N-Myc tag HG15140-NM
SRPR qPCR Primer Pairs, Human HP103767
info info
添加购物车成功! 添加购物车失败!