SRM cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52162-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SRM Reagents
CRO Services
Product recommended

All SRM Reagents
SRM cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
909 bp
Description
Full length Clone DNA of Mouse spermidine synthase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRM cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AA407669 cDNA ORF Clone, Mouse;SpdST cDNA ORF Clone, Mouse;SpdSy cDNA ORF Clone, Mouse
SRM Background Information
Full Name
spermidine synthase

SRM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRM cDNA ORF Clone in Cloning Vector, Mouse MG52162-G
SRM cDNA ORF Clone, Mouse, untagged MG52162-UT
SRM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52162-ACGLN
SRM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52162-ACG
SRM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52162-ANG
SRM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52162-ACR
SRM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52162-ANR
SRM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52162-CF
SRM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52162-NF
SRM cDNA ORF Clone, Mouse, C-His tag MG52162-CH
SRM cDNA ORF Clone, Mouse, N-His tag MG52162-NH
SRM cDNA ORF Clone, Mouse, C-HA tag MG52162-CY
SRM cDNA ORF Clone, Mouse, N-HA tag MG52162-NY
SRM cDNA ORF Clone, Mouse, C-Myc tag MG52162-CM
SRM qPCR Primer Pairs, Mouse MP202035

SRM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRM cDNA ORF Clone in Cloning Vector, Human HG14261-G
SRM cDNA ORF Clone, Human, untagged HG14261-UT
SRM cDNA ORF Clone, Human, C-GFPSpark® tag HG14261-ACG
SRM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14261-ACGLN
SRM cDNA ORF Clone, Human, N-GFPSpark® tag HG14261-ANG
SRM cDNA ORF Clone, Human, C-OFPSpark® tag HG14261-ACR
SRM cDNA ORF Clone, Human, N-OFPSpark® tag HG14261-ANR
SRM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14261-CF
SRM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14261-NF
SRM cDNA ORF Clone, Human, C-His tag HG14261-CH
SRM cDNA ORF Clone, Human, N-His tag HG14261-NH
SRM cDNA ORF Clone, Human, C-HA tag HG14261-CY
SRM cDNA ORF Clone, Human, N-HA tag HG14261-NY
SRM cDNA ORF Clone, Human, C-Myc tag HG14261-CM
SRM cDNA ORF Clone, Human, N-Myc tag HG14261-NM
SRM qPCR Primer Pairs, Human HP102911
info info
添加购物车成功! 添加购物车失败!