Quick Order

Mouse Sorcin Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse SRI cDNA Clone Product Information
    NCBI RefSeq:NM_025618.3
    RefSeq ORF Size:552bp
    cDNA Description:Full length Clone DNA of Mus musculus sorcin with N terminal Flag tag.
    Gene Synonym:Sor, 2210417O06Rik, 2900070H08Rik
    Species:Mouse
    Vector:pCMV3-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Sorcin was originally identified in multidrug-resistant cells. It is a alcium-binding protein. Sorcin modulates excitation-contraction coupling in the heart, contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Sorcin is overexpressed in the multi-drug resistant chinese hamster ovary cell line CHRC5 and a variety of multidrug-resistant tumor cell lines, but overexpression is not a sufficient or necessary condition for the acquisition of the multidrug-resistant phenotype.

    References
  • Meyers MB, et al. (1995) Association of sorcin with the cardiac ryanodine receptor. J Biol Chem. 270(44):26411-8.
  • Brownawell AM, et al. (1997) Calcium-dependent binding of sorcin to the N-terminal domain of synexin (annexin VII). J Biol Chem. 272(35):22182-90.
  • Hansen, et al. (2003) The PEF family proteins sorcin and grancalcin interact in vivo and in vitro. FEBS Lett. 545(2-3):151-4.
  • Size / Price
    Catalog: MG52957-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"