Src cDNA ORF Clone, Mouse, C-His tag

Cat: MG51118-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Src Reagents
CRO Services
Product recommended

All Src Reagents
Src cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1626 bp
Description
Full length Clone DNA of Mouse Rous sarcoma oncogene transcript variant 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Src cDNA ORF Clone, Mouse, C-His tag Alternative Names
AW259666 cDNA ORF Clone, Mouse;pp60c-src cDNA ORF Clone, Mouse
Src Background Information

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

Full Name
SRC proto-oncogene, non-receptor tyrosine kinase
References
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Src cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Src cDNA ORF Clone in Cloning Vector, Mouse MG50311-M
    Src cDNA ORF Clone in Cloning Vector, Mouse MG51118-G
    Src cDNA ORF Clone, Mouse, untagged MG51118-UT
    Src cDNA ORF Clone, Mouse, untagged MG50311-UT
    Src cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51118-ACG
    Src Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51118-ACGLN
    Src cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50311-ACG
    Src Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50311-ACGLN
    Src cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51118-ANG
    Src cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51118-ACR
    Src cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50311-ACR
    Src cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51118-ANR
    Src cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50311-CF
    Src cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51118-G-F
    Src cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51118-CF
    Src cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51118-NF
    Src cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50311-NF
    Src cDNA ORF Clone, Mouse, C-His tag MG50311-CH
    Src cDNA ORF Clone, Mouse, N-His tag MG51118-NH
    Src cDNA ORF Clone, Mouse, N-His tag MG50311-NH
    Src cDNA ORF Clone, Mouse, C-HA tag MG50311-CY
    Src cDNA ORF Clone, Mouse, C-HA tag MG51118-CY
    Src cDNA ORF Clone, Mouse, N-HA tag MG50311-NY
    Src cDNA ORF Clone, Mouse, N-HA tag MG51118-NY
    Src cDNA ORF Clone, Mouse, C-Myc tag MG51118-CM
    Src cDNA ORF Clone, Mouse, C-Myc tag MG50311-CM
    Src cDNA ORF Clone, Mouse, N-Myc tag MG50311-NM
    Src cDNA ORF Clone, Mouse, N-Myc tag MG51118-NM
    Src qPCR Primer Pairs, Mouse MP200334

    Src cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Src cDNA ORF Clone in Cloning Vector, Human HG10755-M
    Src cDNA ORF Clone, Human, untagged HG10755-UT
    Src Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10755-ACGLN
    Src cDNA ORF Clone, Human, C-GFPSpark® tag HG10755-ACG
    Src cDNA ORF Clone, Human, N-GFPSpark® tag HG10755-ANG
    Src cDNA ORF Clone, Human, C-OFPSpark® tag HG10755-ACR
    Src cDNA ORF Clone, Human, N-OFPSpark® tag HG10755-ANR
    Src cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10755-CF
    Src cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10755-NF
    Src cDNA ORF Clone, Human, C-His tag HG10755-CH
    Src cDNA ORF Clone, Human, N-His tag HG10755-NH
    Src cDNA ORF Clone, Human, C-HA tag HG10755-CY
    Src cDNA ORF Clone, Human, N-HA tag HG10755-NY
    Src cDNA ORF Clone, Human, C-Myc tag HG10755-CM
    Src cDNA ORF Clone, Human, N-Myc tag HG10755-NM
    Src qPCR Primer Pairs, Human HP100685
    info info
    添加购物车成功! 添加购物车失败!