After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse SRC cDNA Clone Product Information
NCBI RefSeq:NM_009271.3
RefSeq ORF Size:1626bp
cDNA Description:Full length Clone DNA of Mus musculus Rous sarcoma oncogene transcript variant 1 with C terminal His tag.
Gene Synonym:AW259666, pp60c-src, Src
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG51118-ACG$245
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG51118-ACR$245
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG51118-ANG$245
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG51118-ANR$245
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG51118-CF$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagMG51118-CH$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagMG51118-CM$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagMG51118-CY$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone in cloning vectorMG51118-G$75
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG51118-G-F$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagMG51118-NF$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagMG51118-NH$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagMG51118-NM$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagMG51118-NY$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmidMG51118-UT$215
 Learn more about expression Vectors
Product nameProduct name
Background

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

References
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Catalog: MG51118-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"