Quick Order

Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse SRC cDNA Clone Product Information
    NCBI RefSeq:NM_009271.3
    RefSeq ORF Size:1626bp
    cDNA Description:Full length Clone DNA of Mus musculus Rous sarcoma oncogene transcript variant 1 with C terminal His tag.
    Gene Synonym:AW259666, pp60c-src, Src
    Species:Mouse
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SRC qPCR primers for gene expression analysis, MP200334 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG51118-ACG$245
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG51118-ACR$245
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG51118-ANG$245
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG51118-ANR$245
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG51118-CF$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagMG51118-CH$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagMG51118-CM$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagMG51118-CY$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone in cloning vectorMG51118-G$75
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG51118-G-F$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagMG51118-NF$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagMG51118-NH$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagMG51118-NM$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagMG51118-NY$215
    Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmidMG51118-UT$215
     Learn more about expression Vectors
    Product nameProduct name
    Background

    Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

    References
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Catalog: MG51118-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"