SQLE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51927-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SQLE Reagents
CRO Services
Product recommended

All SQLE Reagents
SQLE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1719 bp
Description
Full length Clone DNA of Mouse squalene epoxidase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SQLE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
AI323792 cDNA ORF Clone, Mouse
SQLE Background Information
Full Name
squalene epoxidase

SQLE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SQLE cDNA ORF Clone in Cloning Vector, Mouse MG51927-U
SQLE cDNA ORF Clone, Mouse, untagged MG51927-UT
SQLE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51927-ACGLN
SQLE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51927-ACG
SQLE cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51927-ANG
SQLE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51927-ACR
SQLE cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51927-ANR
SQLE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51927-CF
SQLE cDNA ORF Clone, Mouse, C-His tag MG51927-CH
SQLE cDNA ORF Clone, Mouse, N-His tag MG51927-NH
SQLE cDNA ORF Clone, Mouse, C-HA tag MG51927-CY
SQLE cDNA ORF Clone, Mouse, N-HA tag MG51927-NY
SQLE cDNA ORF Clone, Mouse, C-Myc tag MG51927-CM
SQLE cDNA ORF Clone, Mouse, N-Myc tag MG51927-NM
SQLE qPCR Primer Pairs, Mouse MP201800

SQLE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SQLE cDNA ORF Clone in Cloning Vector, Human HG21419-U
SQLE cDNA ORF Clone, Human, untagged HG21419-UT
SQLE cDNA ORF Clone, Human, C-GFPSpark® tag HG21419-ACG
SQLE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21419-ACGLN
SQLE cDNA ORF Clone, Human, N-GFPSpark® tag HG21419-ANG
SQLE cDNA ORF Clone, Human, C-OFPSpark® tag HG21419-ACR
SQLE cDNA ORF Clone, Human, N-OFPSpark® tag HG21419-ANR
SQLE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21419-CF
SQLE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21419-NF
SQLE cDNA ORF Clone, Human, C-His tag HG21419-CH
SQLE cDNA ORF Clone, Human, N-His tag HG21419-NH
SQLE cDNA ORF Clone, Human, C-HA tag HG21419-CY
SQLE cDNA ORF Clone, Human, N-HA tag HG21419-NY
SQLE cDNA ORF Clone, Human, C-Myc tag HG21419-CM
SQLE cDNA ORF Clone, Human, N-Myc tag HG21419-NM
info info
添加购物车成功! 添加购物车失败!