F-Spondin cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50604-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All F-Spondin Reagents
CRO Services
Product recommended

All F-Spondin Reagents
F-Spondin cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2424 bp
Description
Full length Clone DNA of Mouse spondin 1, (f-spondin) extracellular matrix protein with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

F-Spondin cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AI666765 cDNA ORF Clone, Mouse;AW455831 cDNA ORF Clone, Mouse;BC020531 cDNA ORF Clone, Mouse;D330035F22Rik cDNA ORF Clone, Mouse;FSP cDNA ORF Clone, Mouse
F-Spondin Background Information
Full Name
spondin 1

F-Spondin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
F-Spondin cDNA ORF Clone in Cloning Vector, Rat RG85367-U
F-Spondin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85367-ACGLN

F-Spondin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
F-Spondin cDNA ORF Clone in Cloning Vector, Mouse MG50604-M
F-Spondin cDNA ORF Clone, Mouse, untagged MG50604-UT
F-Spondin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50604-ACGLN
F-Spondin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50604-ACG
F-Spondin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50604-ACR
F-Spondin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50604-CF
F-Spondin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50604-NF
F-Spondin cDNA ORF Clone, Mouse, C-His tag MG50604-CH
F-Spondin cDNA ORF Clone, Mouse, N-His tag MG50604-NH
F-Spondin cDNA ORF Clone, Mouse, N-HA tag MG50604-NY
F-Spondin cDNA ORF Clone, Mouse, C-Myc tag MG50604-CM
F-Spondin cDNA ORF Clone, Mouse, N-Myc tag MG50604-NM
F-Spondin qPCR Primer Pairs, Mouse MP200590

F-Spondin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
F-Spondin cDNA ORF Clone in Cloning Vector, Human HG10582-M
F-Spondin cDNA ORF Clone, Human, untagged HG10582-UT
F-Spondin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10582-ACGLN
F-Spondin cDNA ORF Clone, Human, C-GFPSpark® tag HG10582-ACG
F-Spondin cDNA ORF Clone, Human, C-OFPSpark® tag HG10582-ACR
F-Spondin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10582-CF
F-Spondin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10582-NF
F-Spondin cDNA ORF Clone, Human, C-His tag HG10582-CH
F-Spondin cDNA ORF Clone, Human, N-His tag HG10582-NH
F-Spondin cDNA ORF Clone, Human, C-HA tag HG10582-CY
F-Spondin cDNA ORF Clone, Human, N-HA tag HG10582-NY
F-Spondin cDNA ORF Clone, Human, C-Myc tag HG10582-CM
F-Spondin cDNA ORF Clone, Human, N-Myc tag HG10582-NM
F-Spondin qPCR Primer Pairs, Human HP100859
info info
添加购物车成功! 添加购物车失败!