SPOCK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50459-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPOCK3 Reagents
CRO Services
Product recommended

All SPOCK3 Reagents
SPOCK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1302 bp
Description
Full length Clone DNA of Mouse sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPOCK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2900045C01Rik cDNA ORF Clone, Mouse;AI428471 cDNA ORF Clone, Mouse;mKIAA4039 cDNA ORF Clone, Mouse
SPOCK3 Background Information
Full Name
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3

SPOCK3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SPOCK3 cDNA ORF Clone in Cloning Vector, Mouse MG50459-G
SPOCK3 cDNA ORF Clone, Mouse, untagged MG50459-UT
SPOCK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50459-ACGLN
SPOCK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50459-ACG
SPOCK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50459-ACR
SPOCK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50459-NF
SPOCK3 cDNA ORF Clone, Mouse, C-His tag MG50459-CH
SPOCK3 cDNA ORF Clone, Mouse, N-His tag MG50459-NH
SPOCK3 cDNA ORF Clone, Mouse, C-HA tag MG50459-CY
SPOCK3 cDNA ORF Clone, Mouse, N-HA tag MG50459-NY
SPOCK3 cDNA ORF Clone, Mouse, C-Myc tag MG50459-CM
SPOCK3 cDNA ORF Clone, Mouse, N-Myc tag MG50459-NM
SPOCK3 qPCR Primer Pairs, Mouse MP200463

SPOCK3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPOCK3 cDNA ORF Clone in Cloning Vector, Human HG13270-G
SPOCK3 cDNA ORF Clone, Human, untagged HG13270-UT
SPOCK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13270-ACGLN
SPOCK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13270-ACG
SPOCK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13270-ACR
SPOCK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13270-CF
SPOCK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13270-NF
SPOCK3 cDNA ORF Clone, Human, C-His tag HG13270-CH
SPOCK3 cDNA ORF Clone, Human, N-His tag HG13270-NH
SPOCK3 cDNA ORF Clone, Human, C-HA tag HG13270-CY
SPOCK3 cDNA ORF Clone, Human, N-HA tag HG13270-NY
SPOCK3 cDNA ORF Clone, Human, C-Myc tag HG13270-CM
SPOCK3 cDNA ORF Clone, Human, N-Myc tag HG13270-NM
SPOCK3 qPCR Primer Pairs, Human HP101979
info info
添加购物车成功! 添加购物车失败!