SPOCK1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50832-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SPOCK1 Reagents
CRO Services
Product recommended

All SPOCK1 Reagents
SPOCK1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1329 bp
Description
Full length Clone DNA of Mouse sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPOCK1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Spock cDNA ORF Clone, Mouse;testican cDNA ORF Clone, Mouse;Ticn1 cDNA ORF Clone, Mouse
SPOCK1 Background Information

Osteonectin, also known as SPOCK1, is an extracellular heparan/chondroitin sulfate proteoglycan. Members of this family are known as testicans, also called SPOCKs. They are characterized structurally by an N-terminal testican-specific domain, a follistatin-like region, a calcium-binding domain, a thyroglobulin-like domain, and an acidic C-terminal domain with two putative glycosaminoglycan attachment sites. SPOCKs are enriched in brain and have been shown to regulate neuronal attachment and outgrowth. They contain inhibitory regions in several domains targeted to different classes of protease, and in some cases may act as protease inhibitors. Osteonectin contains 1 Kazal-like domain and 1 thyroglobulin type-1 domain. Up to now, little is known about osteonectin’s function. It may play a role in cell-cell and cell-matrix interactions. Osteonectin also may contribute to various neuronal mechanisms in the central nervous system.

Full Name
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
References
  • Alliel P.M., et al.,(1993), Testican, a multidomain testicular proteoglycan resembling modulators of cell social behaviour. Eur. J. Biochem. 214:347-350.
  • Marr H.S., et al., (1997), Endothelial cell expression of testican mRNA.Endothelium 5:209-219.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • SPOCK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SPOCK1 cDNA ORF Clone in Cloning Vector, Mouse MG50832-G
    SPOCK1 cDNA ORF Clone, Mouse, untagged MG50832-UT
    SPOCK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50832-ACGLN
    SPOCK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50832-ACG
    SPOCK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50832-ACR
    SPOCK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50832-CF
    SPOCK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50832-NF
    SPOCK1 cDNA ORF Clone, Mouse, C-His tag MG50832-CH
    SPOCK1 cDNA ORF Clone, Mouse, N-His tag MG50832-NH
    SPOCK1 cDNA ORF Clone, Mouse, C-HA tag MG50832-CY
    SPOCK1 cDNA ORF Clone, Mouse, N-HA tag MG50832-NY
    SPOCK1 cDNA ORF Clone, Mouse, C-Myc tag MG50832-CM
    SPOCK1 qPCR Primer Pairs, Mouse MP200803

    SPOCK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SPOCK1 cDNA ORF Clone in Cloning Vector, Human HG10644-G
    SPOCK1 cDNA ORF Clone, Human, untagged HG10644-UT
    SPOCK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10644-ACG
    SPOCK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10644-ACGLN
    SPOCK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10644-ACR
    SPOCK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10644-CF
    SPOCK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10644-NF
    SPOCK1 cDNA ORF Clone, Human, C-His tag HG10644-CH
    SPOCK1 cDNA ORF Clone, Human, N-His tag HG10644-NH
    SPOCK1 cDNA ORF Clone, Human, C-HA tag HG10644-CY
    SPOCK1 cDNA ORF Clone, Human, N-HA tag HG10644-NY
    SPOCK1 cDNA ORF Clone, Human, C-Myc tag HG10644-CM
    SPOCK1 cDNA ORF Clone, Human, N-Myc tag HG10644-NM
    SPOCK1 qPCR Primer Pairs, Human HP100617
    info info
    添加购物车成功! 添加购物车失败!