Quick Order

Mouse SPOCK1 / Testican 1 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse SPOCK1 cDNA Clone Product Information
    NCBI RefSeq:NM_009262.3
    RefSeq ORF Size:1329bp
    cDNA Description:Full length Clone DNA of Mus musculus sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 with N terminal His tag.
    Gene Synonym:Spock, Ticn1, testican, Spock1
    Species:Mouse
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SPOCK1 qPCR primers for gene expression analysis, MP200803 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Osteonectin, also known as SPOCK1, is an extracellular heparan/chondroitin sulfate proteoglycan. Members of this family are known as testicans, also called SPOCKs. They are characterized structurally by an N-terminal testican-specific domain, a follistatin-like region, a calcium-binding domain, a thyroglobulin-like domain, and an acidic C-terminal domain with two putative glycosaminoglycan attachment sites. SPOCKs are enriched in brain and have been shown to regulate neuronal attachment and outgrowth. They contain inhibitory regions in several domains targeted to different classes of protease, and in some cases may act as protease inhibitors. Osteonectin contains 1 Kazal-like domain and 1 thyroglobulin type-1 domain. Up to now, little is known about osteonectin’s function. It may play a role in cell-cell and cell-matrix interactions. Osteonectin also may contribute to various neuronal mechanisms in the central nervous system.

    Size / Price
    Catalog: MG50832-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"