After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SPOCK1 / Testican 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse SPOCK1 cDNA Clone Product Information
NCBI RefSeq:NM_009262.3
RefSeq ORF Size:1329bp
cDNA Description:Full length Clone DNA of Mus musculus sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 with N terminal His tag.
Gene Synonym:Spock, Ticn1, testican, Spock1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Osteonectin, also known as SPOCK1, is an extracellular heparan/chondroitin sulfate proteoglycan. Members of this family are known as testicans, also called SPOCKs. They are characterized structurally by an N-terminal testican-specific domain, a follistatin-like region, a calcium-binding domain, a thyroglobulin-like domain, and an acidic C-terminal domain with two putative glycosaminoglycan attachment sites. SPOCKs are enriched in brain and have been shown to regulate neuronal attachment and outgrowth. They contain inhibitory regions in several domains targeted to different classes of protease, and in some cases may act as protease inhibitors. Osteonectin contains 1 Kazal-like domain and 1 thyroglobulin type-1 domain. Up to now, little is known about osteonectin’s function. It may play a role in cell-cell and cell-matrix interactions. Osteonectin also may contribute to various neuronal mechanisms in the central nervous system.

Size / Price
Catalog: MG50832-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"