SPNS1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52583-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SPNS1 Reagents
CRO Services
Product recommended

All SPNS1 Reagents
SPNS1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1587 bp
Description
Full length Clone DNA of Mouse spinster homolog 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPNS1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2210013K02Rik cDNA ORF Clone, Mouse;Spin1 cDNA ORF Clone, Mouse;Spinl cDNA ORF Clone, Mouse
SPNS1 Background Information
Full Name
spinster homolog 1 (Drosophila)

SPNS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SPNS1 cDNA ORF Clone in Cloning Vector, Rat RG81654-G
SPNS1 cDNA ORF Clone, Rat, untagged RG81654-UT
SPNS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81654-ACGLN
SPNS1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81654-ACG
SPNS1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81654-ANG
SPNS1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81654-ACR
SPNS1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81654-ANR
SPNS1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81654-CF
SPNS1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81654-NF
SPNS1 cDNA ORF Clone, Rat, C-His tag RG81654-CH
SPNS1 cDNA ORF Clone, Rat, N-His tag RG81654-NH
SPNS1 cDNA ORF Clone, Rat, C-HA tag RG81654-CY
SPNS1 cDNA ORF Clone, Rat, N-HA tag RG81654-NY
SPNS1 cDNA ORF Clone, Rat, C-Myc tag RG81654-CM
SPNS1 cDNA ORF Clone, Rat, N-Myc tag RG81654-NM

SPNS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SPNS1 cDNA ORF Clone in Cloning Vector, Mouse MG52583-G
SPNS1 cDNA ORF Clone, Mouse, untagged MG52583-UT
SPNS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52583-ACG
SPNS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52583-ACGLN
SPNS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52583-ANG
SPNS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52583-ACR
SPNS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52583-ANR
SPNS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52583-CF
SPNS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52583-NF
SPNS1 cDNA ORF Clone, Mouse, C-His tag MG52583-CH
SPNS1 cDNA ORF Clone, Mouse, C-HA tag MG52583-CY
SPNS1 cDNA ORF Clone, Mouse, N-HA tag MG52583-NY
SPNS1 cDNA ORF Clone, Mouse, C-Myc tag MG52583-CM
SPNS1 cDNA ORF Clone, Mouse, N-Myc tag MG52583-NM
SPNS1 qPCR Primer Pairs, Mouse MP202454
info info
添加购物车成功! 添加购物车失败!