SNX11 cDNA ORF Clone, Mouse, untagged

Cat: MG51612-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SNX11 Reagents
CRO Services
Product recommended

All SNX11 Reagents
SNX11 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Mouse sorting nexin 11.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNX11 cDNA ORF Clone, Mouse, untagged Alternative Names
4933439F10Rik cDNA ORF Clone, Mouse;A930041K09Rik cDNA ORF Clone, Mouse;AI117694 cDNA ORF Clone, Mouse
SNX11 Background Information
Full Name
sorting nexin 11

SNX11 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SNX11 cDNA ORF Clone in Cloning Vector, Rhesus CG90385-G
SNX11 cDNA ORF Clone, Rhesus, untagged CG90385-UT
SNX11 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90385-ACGLN
SNX11 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90385-ACG
SNX11 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90385-ANG
SNX11 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90385-ACR
SNX11 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90385-ANR
SNX11 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90385-CF
SNX11 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90385-NF
SNX11 cDNA ORF Clone, Rhesus, C-His tag CG90385-CH
SNX11 cDNA ORF Clone, Rhesus, N-His tag CG90385-NH
SNX11 cDNA ORF Clone, Rhesus, C-HA tag CG90385-CY
SNX11 cDNA ORF Clone, Rhesus, N-HA tag CG90385-NY
SNX11 cDNA ORF Clone, Rhesus, C-Myc tag CG90385-CM
SNX11 cDNA ORF Clone, Rhesus, N-Myc tag CG90385-NM

SNX11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNX11 cDNA ORF Clone in Cloning Vector, Mouse MG51612-U
SNX11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51612-ACGLN
SNX11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51612-ACG
SNX11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51612-ANG
SNX11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51612-ACR
SNX11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51612-ANR
SNX11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51612-CF
SNX11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51612-NF
SNX11 cDNA ORF Clone, Mouse, C-His tag MG51612-CH
SNX11 cDNA ORF Clone, Mouse, N-His tag MG51612-NH
SNX11 cDNA ORF Clone, Mouse, C-HA tag MG51612-CY
SNX11 cDNA ORF Clone, Mouse, N-HA tag MG51612-NY
SNX11 cDNA ORF Clone, Mouse, C-Myc tag MG51612-CM
SNX11 cDNA ORF Clone, Mouse, N-Myc tag MG51612-NM
SNX11 qPCR Primer Pairs, Mouse MP201279
info info
添加购物车成功! 添加购物车失败!