SNRPE cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51271-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SNRPE Reagents
CRO Services
Product recommended

All SNRPE Reagents
SNRPE cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
279 bp
Description
Full length Clone DNA of Mouse small nuclear ribonucleoprotein E with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNRPE cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AL022645 cDNA ORF Clone, Mouse;C76690 cDNA ORF Clone, Mouse;SME cDNA ORF Clone, Mouse
SNRPE Background Information
Full Name
small nuclear ribonucleoprotein polypeptide E

SNRPE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNRPE cDNA ORF Clone in Cloning Vector, Mouse MG51271-U
SNRPE cDNA ORF Clone, Mouse, untagged MG51271-UT
SNRPE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51271-ACGLN
SNRPE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51271-ACG
SNRPE cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51271-ANG
SNRPE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51271-ACR
SNRPE cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51271-ANR
SNRPE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51271-CF
SNRPE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51271-NF
SNRPE cDNA ORF Clone, Mouse, C-His tag MG51271-CH
SNRPE cDNA ORF Clone, Mouse, N-His tag MG51271-NH
SNRPE cDNA ORF Clone, Mouse, N-HA tag MG51271-NY
SNRPE cDNA ORF Clone, Mouse, C-Myc tag MG51271-CM
SNRPE cDNA ORF Clone, Mouse, N-Myc tag MG51271-NM
SNRPE qPCR Primer Pairs, Mouse MP201153

SNRPE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNRPE cDNA ORF Clone in Cloning Vector, Human HG18447-U
SNRPE cDNA ORF Clone, Human, untagged HG18447-UT
SNRPE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18447-ACGLN
SNRPE cDNA ORF Clone, Human, C-GFPSpark® tag HG18447-ACG
SNRPE cDNA ORF Clone, Human, N-GFPSpark® tag HG18447-ANG
SNRPE cDNA ORF Clone, Human, C-OFPSpark® tag HG18447-ACR
SNRPE cDNA ORF Clone, Human, N-OFPSpark® tag HG18447-ANR
SNRPE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18447-CF
SNRPE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18447-NF
SNRPE cDNA ORF Clone, Human, C-His tag HG18447-CH
SNRPE cDNA ORF Clone, Human, N-His tag HG18447-NH
SNRPE cDNA ORF Clone, Human, C-HA tag HG18447-CY
SNRPE cDNA ORF Clone, Human, N-HA tag HG18447-NY
SNRPE cDNA ORF Clone, Human, C-Myc tag HG18447-CM
SNRPE cDNA ORF Clone, Human, N-Myc tag HG18447-NM
info info
添加购物车成功! 添加购物车失败!