SNRPA cDNA ORF Clone, Mouse, N-His tag

Cat: MG52673-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SNRPA Reagents
CRO Services
Product recommended

All SNRPA Reagents
SNRPA cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
864 bp
Description
Full length Clone DNA of Mouse small nuclear ribonucleoprotein polypeptide A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNRPA cDNA ORF Clone, Mouse, N-His tag Alternative Names
C430021M15Rik cDNA ORF Clone, Mouse;Rnu1a-1 cDNA ORF Clone, Mouse;Rnu1a1 cDNA ORF Clone, Mouse;U1-A cDNA ORF Clone, Mouse;U1A cDNA ORF Clone, Mouse
SNRPA Background Information
Full Name
small nuclear ribonucleoprotein polypeptide A

SNRPA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNRPA cDNA ORF Clone in Cloning Vector, Mouse MG52673-G
SNRPA cDNA ORF Clone, Mouse, untagged MG52673-UT
SNRPA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52673-ACG
SNRPA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52673-ACGLN
SNRPA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52673-ANG
SNRPA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52673-ACR
SNRPA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52673-ANR
SNRPA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52673-CF
SNRPA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52673-NF
SNRPA cDNA ORF Clone, Mouse, C-His tag MG52673-CH
SNRPA cDNA ORF Clone, Mouse, C-HA tag MG52673-CY
SNRPA cDNA ORF Clone, Mouse, N-HA tag MG52673-NY
SNRPA cDNA ORF Clone, Mouse, C-Myc tag MG52673-CM
SNRPA cDNA ORF Clone, Mouse, N-Myc tag MG52673-NM
SNRPA qPCR Primer Pairs, Mouse MP202544

SNRPA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNRPA cDNA ORF Clone in Cloning Vector, Human HG16978-U
SNRPA cDNA ORF Clone, Human, untagged HG16978-UT
SNRPA cDNA ORF Clone, Human, C-GFPSpark® tag HG16978-ACG
SNRPA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16978-ACGLN
SNRPA cDNA ORF Clone, Human, N-GFPSpark® tag HG16978-ANG
SNRPA cDNA ORF Clone, Human, C-OFPSpark® tag HG16978-ACR
SNRPA cDNA ORF Clone, Human, N-OFPSpark® tag HG16978-ANR
SNRPA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16978-CF
SNRPA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16978-NF
SNRPA cDNA ORF Clone, Human, C-His tag HG16978-CH
SNRPA cDNA ORF Clone, Human, N-His tag HG16978-NH
SNRPA cDNA ORF Clone, Human, C-HA tag HG16978-CY
SNRPA cDNA ORF Clone, Human, N-HA tag HG16978-NY
SNRPA cDNA ORF Clone, Human, C-Myc tag HG16978-CM
SNRPA cDNA ORF Clone, Human, N-Myc tag HG16978-NM
info info
添加购物车成功! 添加购物车失败!