SPF30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51666-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPF30 Reagents
CRO Services
Product recommended

All SPF30 Reagents
SPF30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
717 bp
Description
Full length Clone DNA of Mouse survival motor neuron domain containing 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPF30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2410004J23Rik cDNA ORF Clone, Mouse;4933440I19Rik cDNA ORF Clone, Mouse
SPF30 Background Information

SMNDC1 gene is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. SMNDC1 is a nuclear protein that has been identified as a constituent of the spliceosome complex. SMNDC1 gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. SMNDC1 is necessary for spliceosome assembly. Its overexpression causes apoptosis.

Full Name
survival motor neuron domain containing 1
References
  • Rappsilber J, et al. (2001) SPF30 is an essential human splicing factor required for assembly of the U4/U5/U6 tri-small nuclear ribonucleoprotein into the spliceosome. J Biol Chem. 276(33): 31142-50.
  • Talbot K, et al. (1999) Characterization of a gene encoding survival motor neuron (SMN)-related protein, a constituent of the spliceosome complex. Hum Mol Genet. 7(13): 2149-56.
  • Neubauer G, et al. (1998) Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat Genet. 20(1):46-50.
  • SPF30 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SPF30 cDNA ORF Clone in Cloning Vector, Rat RG80521-U
    SPF30 cDNA ORF Clone, Rat, untagged RG80521-UT
    SPF30 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80521-ACGLN
    SPF30 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80521-ACG
    SPF30 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80521-ANG
    SPF30 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80521-ACR
    SPF30 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80521-ANR
    SPF30 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80521-CF
    SPF30 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80521-NF
    SPF30 cDNA ORF Clone, Rat, C-His tag RG80521-CH
    SPF30 cDNA ORF Clone, Rat, N-His tag RG80521-NH
    SPF30 cDNA ORF Clone, Rat, C-HA tag RG80521-CY
    SPF30 cDNA ORF Clone, Rat, N-HA tag RG80521-NY
    SPF30 cDNA ORF Clone, Rat, C-Myc tag RG80521-CM
    SPF30 cDNA ORF Clone, Rat, N-Myc tag RG80521-NM
    SPF30 qPCR Primer Pairs, Rat RP300485

    SPF30 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SPF30 cDNA ORF Clone in Cloning Vector, Mouse MG51666-G
    SPF30 cDNA ORF Clone, Mouse, untagged MG51666-UT
    SPF30 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51666-ACGLN
    SPF30 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51666-ACG
    SPF30 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51666-ANG
    SPF30 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51666-ACR
    SPF30 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51666-ANR
    SPF30 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51666-NF
    SPF30 cDNA ORF Clone, Mouse, C-His tag MG51666-CH
    SPF30 cDNA ORF Clone, Mouse, N-His tag MG51666-NH
    SPF30 cDNA ORF Clone, Mouse, C-HA tag MG51666-CY
    SPF30 cDNA ORF Clone, Mouse, N-HA tag MG51666-NY
    SPF30 cDNA ORF Clone, Mouse, C-Myc tag MG51666-CM
    SPF30 cDNA ORF Clone, Mouse, N-Myc tag MG51666-NM
    SPF30 qPCR Primer Pairs, Mouse MP201539

    SPF30 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SPF30 cDNA ORF Clone in Cloning Vector, Human HG14294-G
    SPF30 cDNA ORF Clone, Human, untagged HG14294-UT
    SPF30 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14294-ACGLN
    SPF30 cDNA ORF Clone, Human, C-GFPSpark® tag HG14294-ACG
    SPF30 cDNA ORF Clone, Human, N-GFPSpark® tag HG14294-ANG
    SPF30 cDNA ORF Clone, Human, C-OFPSpark® tag HG14294-ACR
    SPF30 cDNA ORF Clone, Human, N-OFPSpark® tag HG14294-ANR
    SPF30 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14294-CF
    SPF30 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14294-NF
    SPF30 cDNA ORF Clone, Human, C-His tag HG14294-CH
    SPF30 cDNA ORF Clone, Human, N-His tag HG14294-NH
    SPF30 cDNA ORF Clone, Human, C-HA tag HG14294-CY
    SPF30 cDNA ORF Clone, Human, N-HA tag HG14294-NY
    SPF30 cDNA ORF Clone, Human, C-Myc tag HG14294-CM
    SPF30 cDNA ORF Clone, Human, N-Myc tag HG14294-NM
    SPF30 qPCR Primer Pairs, Human HP102944
    info info
    添加购物车成功! 添加购物车失败!