After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SMNDC1/ SPF30 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse SMNDC1 cDNA Clone Product Information
NCBI RefSeq:NM_172429.2
RefSeq ORF Size:717bp
cDNA Description:Full length Clone DNA of Mus musculus survival motor neuron domain containing 1 with C terminal Myc tag.
Gene Synonym:2410004J23Rik, 4933440I19Rik
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SMNDC1 gene is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. SMNDC1 is a nuclear protein that has been identified as a constituent of the spliceosome complex. SMNDC1 gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. SMNDC1 is necessary for spliceosome assembly. Its overexpression causes apoptosis.

References
  • Rappsilber J, et al. (2001) SPF30 is an essential human splicing factor required for assembly of the U4/U5/U6 tri-small nuclear ribonucleoprotein into the spliceosome. J Biol Chem. 276(33): 31142-50.
  • Talbot K, et al. (1999) Characterization of a gene encoding survival motor neuron (SMN)-related protein, a constituent of the spliceosome complex. Hum Mol Genet. 7(13): 2149-56.
  • Neubauer G, et al. (1998) Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat Genet. 20(1):46-50.
  • Size / Price
    Catalog: MG51666-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"