SMIM7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51263-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SMIM7 Reagents
CRO Services
Product recommended

All SMIM7 Reagents
SMIM7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
228 bp
Description
Full length Clone DNA of Mouse small integral membrane protein 7 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SMIM7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
9130011J15Rik cDNA ORF Clone, Mouse
SMIM7 Background Information
Full Name
small integral membrane protein 7

SMIM7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SMIM7 cDNA ORF Clone in Cloning Vector, Rat RG80840-U
SMIM7 cDNA ORF Clone, Rat, untagged RG80840-UT
SMIM7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80840-ACG
SMIM7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80840-ACGLN
SMIM7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80840-ACR
SMIM7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80840-CF
SMIM7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80840-NF
SMIM7 cDNA ORF Clone, Rat, C-His tag RG80840-CH
SMIM7 cDNA ORF Clone, Rat, N-His tag RG80840-NH
SMIM7 cDNA ORF Clone, Rat, C-HA tag RG80840-CY
SMIM7 cDNA ORF Clone, Rat, N-HA tag RG80840-NY
SMIM7 cDNA ORF Clone, Rat, C-Myc tag RG80840-CM
SMIM7 cDNA ORF Clone, Rat, N-Myc tag RG80840-NM
SMIM7 qPCR Primer Pairs, Rat RP300804

SMIM7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SMIM7 cDNA ORF Clone in Cloning Vector, Mouse MG51263-U
SMIM7 cDNA ORF Clone, Mouse, untagged MG51263-UT
SMIM7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51263-ACGLN
SMIM7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51263-ACG
SMIM7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51263-ACR
SMIM7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51263-CF
SMIM7 cDNA ORF Clone, Mouse, C-His tag MG51263-CH
SMIM7 cDNA ORF Clone, Mouse, N-His tag MG51263-NH
SMIM7 cDNA ORF Clone, Mouse, C-HA tag MG51263-CY
SMIM7 cDNA ORF Clone, Mouse, N-HA tag MG51263-NY
SMIM7 cDNA ORF Clone, Mouse, C-Myc tag MG51263-CM
SMIM7 cDNA ORF Clone, Mouse, N-Myc tag MG51263-NM
SMIM7 qPCR Primer Pairs, Mouse MP201145
info info
添加购物车成功! 添加购物车失败!