SMIM12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51958-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SMIM12 Reagents
CRO Services
Product recommended

All SMIM12 Reagents
SMIM12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
279 bp
Description
Full length Clone DNA of Mouse small integral membrane protein 12 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SMIM12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
BC003266 cDNA ORF Clone, Mouse
SMIM12 Background Information
Full Name
small integral membrane protein 12

SMIM12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SMIM12 cDNA ORF Clone in Cloning Vector, Mouse MG51958-G
SMIM12 cDNA ORF Clone, Mouse, untagged MG51958-UT
SMIM12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51958-ACG
SMIM12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51958-ACGLN
SMIM12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51958-ANG
SMIM12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51958-ACR
SMIM12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51958-ANR
SMIM12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51958-CF
SMIM12 cDNA ORF Clone, Mouse, C-His tag MG51958-CH
SMIM12 cDNA ORF Clone, Mouse, N-His tag MG51958-NH
SMIM12 cDNA ORF Clone, Mouse, C-HA tag MG51958-CY
SMIM12 cDNA ORF Clone, Mouse, N-HA tag MG51958-NY
SMIM12 cDNA ORF Clone, Mouse, C-Myc tag MG51958-CM
SMIM12 cDNA ORF Clone, Mouse, N-Myc tag MG51958-NM
SMIM12 qPCR Primer Pairs, Mouse MP201831

SMIM12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SMIM12 cDNA ORF Clone in Cloning Vector, Human HG27361-U
SMIM12 cDNA ORF Clone, Human, untagged HG27361-UT
SMIM12 cDNA ORF Clone, Human, C-GFPSpark® tag HG27361-ACG
SMIM12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG27361-ACGLN
SMIM12 cDNA ORF Clone, Human, N-GFPSpark® tag HG27361-ANG
SMIM12 cDNA ORF Clone, Human, C-OFPSpark® tag HG27361-ACR
SMIM12 cDNA ORF Clone, Human, N-OFPSpark® tag HG27361-ANR
SMIM12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG27361-CF
SMIM12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG27361-NF
SMIM12 cDNA ORF Clone, Human, C-His tag HG27361-CH
SMIM12 cDNA ORF Clone, Human, N-His tag HG27361-NH
SMIM12 cDNA ORF Clone, Human, C-HA tag HG27361-CY
SMIM12 cDNA ORF Clone, Human, N-HA tag HG27361-NY
SMIM12 cDNA ORF Clone, Human, C-Myc tag HG27361-CM
SMIM12 cDNA ORF Clone, Human, N-Myc tag HG27361-NM
info info
添加购物车成功! 添加购物车失败!