CD98 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50813-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD98 Reagents
CRO Services
Product recommended

All CD98 Reagents
CD98 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1698 bp
Description
Full length Clone DNA of Mouse solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD98 cDNA ORF Clone, Mouse, N-His tag Alternative Names
4F2 cDNA ORF Clone, Mouse;4F2HC cDNA ORF Clone, Mouse;AI314110 cDNA ORF Clone, Mouse;Cd98 cDNA ORF Clone, Mouse;Ly-10 cDNA ORF Clone, Mouse;Ly-m10 cDNA ORF Clone, Mouse;Ly10 cDNA ORF Clone, Mouse;Mdu1 cDNA ORF Clone, Mouse;Mgp-2hc cDNA ORF Clone, Mouse;NACAE cDNA ORF Clone, Mouse
CD98 Background Information

4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen 4F2 large subunit, CD98, SLC3A2 and MDU1, is a single-pass type I I membrane protein which belongs to the SLC3A transporter family. SLC3A2 / MDU1 is expressed ubiquitously in all tissues tested with highest levels detected in kidney, placenta and testis and weakest level in thymus. During gestation, expression in the placenta is significantly stronger at full-term than at the mid-trimester stage. SLC3A2 / MDU1 is expressed in HUVECS and at low levels in resting peripheral blood T-lymphocytes and quiescent fibroblasts. It is expressed in fetal liver and in the astrocytic process of primary astrocytic gliomas. SLC3A2 / MDU1 is also expressed in retinal endothelial cells and in the intestinal epithelial cell line Caco2-BBE. SLC3A2 / MDU1 is required for the function of light chain amino-acid transporters. It involved in sodium-independent, high-affinity transport of large neutral amino acids such as phenylalanine, tyrosine, leucine, arginine and tryptophan. SLC3A2 / MDU1 is involved in guiding and targeting of LAT1 and LAT2 to the plasma membrane. When associated with SLC7A6 or SLC7A7, SLC3A2 / MDU1 acts as an arginine/glutamine exchanger, following an antiport mechanism for amino acid transport, influencing arginine release in exchange for extracellular amino acids. SLC3A2 / MDU1 plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine. It is required for normal and neoplastic cell growth. When associated with SLC7A5/LAT1, SLC3A2 / MDU1 is also involved in the transport of L-DOPA across the blood-brain barrier, and that of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane in tissues such as placenta.

Full Name
solute carrier family 3 (amino acid transporter heavy chain), member 2
References
  • Torrents D. et al., 1998, J Biol Chem. 273: 32437-45.
  • Pfeiffer R. et al., 1999, EMBO J. 18: 49-57.
  • Broeer A. et al., 2000, Biochem J. 349: 787-95.
  • Yanagida O. et al., 2001, Biochim Biophys Acta. 1514: 291-302.
  • Broeer A. et al., 2001, Biochem J. 355: 725-31.
  • Fort J. et al., 2007, J Biol Chem. 282: 31444-52.
  • Mayya V. et al., 2009, Sci Signal. 2: RA46-RA46.
  • CD98 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD98 cDNA ORF Clone in Cloning Vector, Rat RG80339-G
    CD98 cDNA ORF Clone, Rat, untagged RG80339-UT
    CD98 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80339-ACGLN
    CD98 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80339-ACG
    CD98 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80339-ACR
    CD98 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80339-CF
    CD98 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80339-NF
    CD98 cDNA ORF Clone, Rat, C-His tag RG80339-CH
    CD98 cDNA ORF Clone, Rat, N-His tag RG80339-NH
    CD98 cDNA ORF Clone, Rat, C-HA tag RG80339-CY
    CD98 cDNA ORF Clone, Rat, N-HA tag RG80339-NY
    CD98 cDNA ORF Clone, Rat, C-Myc tag RG80339-CM
    CD98 cDNA ORF Clone, Rat, N-Myc tag RG80339-NM
    CD98 qPCR Primer Pairs, Rat RP300309

    CD98 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD98 cDNA ORF Clone in Cloning Vector, Mouse MG50813-G
    CD98 cDNA ORF Clone, Mouse, untagged MG50813-UT
    CD98 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50813-ACG
    CD98 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50813-ACGLN
    CD98 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50813-ACR
    CD98 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50813-CF
    CD98 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50813-NF
    CD98 cDNA ORF Clone, Mouse, C-His tag MG50813-CH
    CD98 cDNA ORF Clone, Mouse, C-HA tag MG50813-CY
    CD98 cDNA ORF Clone, Mouse, N-HA tag MG50813-NY
    CD98 cDNA ORF Clone, Mouse, C-Myc tag MG50813-CM
    CD98 cDNA ORF Clone, Mouse, N-Myc tag MG50813-NM
    CD98 qPCR Primer Pairs, Mouse MP200784

    CD98 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD98 cDNA ORF Clone in Cloning Vector, Human HG16415-G
    CD98 cDNA ORF Clone, Human, untagged HG16415-UT
    CD98 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16415-ACGLN
    CD98 cDNA ORF Clone, Human, C-GFPSpark® tag HG16415-ACG
    CD98 cDNA ORF Clone, Human, C-OFPSpark® tag HG16415-ACR
    CD98 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16415-CF
    CD98 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16415-NF
    CD98 cDNA ORF Clone, Human, C-His tag HG16415-CH
    CD98 cDNA ORF Clone, Human, N-His tag HG16415-NH
    CD98 cDNA ORF Clone, Human, C-HA tag HG16415-CY
    CD98 cDNA ORF Clone, Human, N-HA tag HG16415-NY
    CD98 cDNA ORF Clone, Human, C-Myc tag HG16415-CM
    CD98 cDNA ORF Clone, Human, N-Myc tag HG16415-NM
    CD98 qPCR Primer Pairs, Human HP105164
    info info
    添加购物车成功! 添加购物车失败!