After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SLC39A7 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse SLC39A7 cDNA Clone Product Information
NCBI RefSeq:NM_001077709.1
RefSeq ORF Size:1431bp
cDNA Description:Full length Clone DNA of Mus musculus solute carrier family 39 (zinc transporter), member 7.
Gene Synonym:Ke4, Ke-4, Zip7, Ring5, H-2Ke4, H2-Ke4, AA408174, AI117660, AL024048
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG52540-UT
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"