SLC25A44 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52845-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SLC25A44 Reagents
CRO Services
Product recommended

All SLC25A44 Reagents
SLC25A44 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Mouse solute carrier family 25, member 44 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A44 cDNA ORF Clone, Mouse, N-His tag Alternative Names
6720482A19 cDNA ORF Clone, Mouse;B430110G05Rik cDNA ORF Clone, Mouse
SLC25A44 Background Information
Full Name
solute carrier family 25, member 44

SLC25A44 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
SLC25A44 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90443-G
SLC25A44 cDNA ORF Clone, Cynomolgus, untagged CG90443-UT
SLC25A44 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90443-ACG
SLC25A44 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90443-ACGLN
SLC25A44 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90443-ACR
SLC25A44 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90443-CF
SLC25A44 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90443-NF
SLC25A44 cDNA ORF Clone, Cynomolgus, C-His tag CG90443-CH
SLC25A44 cDNA ORF Clone, Cynomolgus, N-His tag CG90443-NH
SLC25A44 cDNA ORF Clone, Cynomolgus, C-HA tag CG90443-CY
SLC25A44 cDNA ORF Clone, Cynomolgus, N-HA tag CG90443-NY
SLC25A44 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90443-CM
SLC25A44 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90443-NM

SLC25A44 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A44 cDNA ORF Clone in Cloning Vector, Mouse MG52845-G
SLC25A44 cDNA ORF Clone, Mouse, untagged MG52845-UT
SLC25A44 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52845-ACGLN
SLC25A44 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52845-ACG
SLC25A44 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52845-ANG
SLC25A44 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52845-ACR
SLC25A44 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52845-ANR
SLC25A44 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52845-CF
SLC25A44 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52845-NF
SLC25A44 cDNA ORF Clone, Mouse, C-His tag MG52845-CH
SLC25A44 cDNA ORF Clone, Mouse, C-HA tag MG52845-CY
SLC25A44 cDNA ORF Clone, Mouse, N-HA tag MG52845-NY
SLC25A44 cDNA ORF Clone, Mouse, C-Myc tag MG52845-CM
SLC25A44 cDNA ORF Clone, Mouse, N-Myc tag MG52845-NM

SLC25A44 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A44 cDNA ORF Clone in Cloning Vector, Human HG24268-U
SLC25A44 cDNA ORF Clone, Human, untagged HG24268-UT
SLC25A44 cDNA ORF Clone, Human, C-GFPSpark® tag HG24268-ACG
SLC25A44 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG24268-ACGLN
SLC25A44 cDNA ORF Clone, Human, N-GFPSpark® tag HG24268-ANG
SLC25A44 cDNA ORF Clone, Human, C-OFPSpark® tag HG24268-ACR
SLC25A44 cDNA ORF Clone, Human, N-OFPSpark® tag HG24268-ANR
SLC25A44 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG24268-CF
SLC25A44 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG24268-NF
SLC25A44 cDNA ORF Clone, Human, C-His tag HG24268-CH
SLC25A44 cDNA ORF Clone, Human, N-His tag HG24268-NH
SLC25A44 cDNA ORF Clone, Human, C-HA tag HG24268-CY
SLC25A44 cDNA ORF Clone, Human, N-HA tag HG24268-NY
SLC25A44 cDNA ORF Clone, Human, C-Myc tag HG24268-CM
SLC25A44 cDNA ORF Clone, Human, N-Myc tag HG24268-NM
info info
添加购物车成功! 添加购物车失败!