SLC25A3 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51799-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A3 Reagents
CRO Services
Product recommended

All SLC25A3 Reagents
SLC25A3 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Mouse solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A3 cDNA ORF Clone, Mouse, C-His tag Alternative Names
5730556H19Rik cDNA ORF Clone, Mouse;Phc cDNA ORF Clone, Mouse;PTP cDNA ORF Clone, Mouse
SLC25A3 Background Information
Full Name
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3

SLC25A3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SLC25A3 cDNA ORF Clone in Cloning Vector, Rhesus CG90738-G
SLC25A3 cDNA ORF Clone, Rhesus, untagged CG90738-UT
SLC25A3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90738-ACGLN
SLC25A3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90738-ACG
SLC25A3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90738-ANG
SLC25A3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90738-ACR
SLC25A3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90738-ANR
SLC25A3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90738-CF
SLC25A3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90738-NF
SLC25A3 cDNA ORF Clone, Rhesus, C-His tag CG90738-CH
SLC25A3 cDNA ORF Clone, Rhesus, N-His tag CG90738-NH
SLC25A3 cDNA ORF Clone, Rhesus, C-HA tag CG90738-CY
SLC25A3 cDNA ORF Clone, Rhesus, N-HA tag CG90738-NY
SLC25A3 cDNA ORF Clone, Rhesus, C-Myc tag CG90738-CM
SLC25A3 cDNA ORF Clone, Rhesus, N-Myc tag CG90738-NM

SLC25A3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC25A3 cDNA ORF Clone in Cloning Vector, Rat RG84076-U
SLC25A3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84076-ACGLN

SLC25A3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A3 cDNA ORF Clone in Cloning Vector, Mouse MG5A7581-U
SLC25A3 cDNA ORF Clone in Cloning Vector, Mouse MG51799-G
SLC25A3 cDNA ORF Clone, Mouse, untagged MG5A7581-UT
SLC25A3 cDNA ORF Clone, Mouse, untagged MG51799-UT
SLC25A3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51799-ACGLN
SLC25A3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51799-ACG
SLC25A3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7581-ACG
SLC25A3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7581-ACGLN
SLC25A3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7581-ANG
SLC25A3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51799-ANG
SLC25A3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51799-ACR
SLC25A3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7581-ACR
SLC25A3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51799-ANR
SLC25A3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7581-ANR
SLC25A3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7581-CF
SLC25A3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51799-CF
SLC25A3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7581-NF
SLC25A3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51799-NF
SLC25A3 cDNA ORF Clone, Mouse, C-His tag MG5A7581-CH
SLC25A3 cDNA ORF Clone, Mouse, N-His tag MG51799-NH
SLC25A3 cDNA ORF Clone, Mouse, N-His tag MG5A7581-NH
SLC25A3 cDNA ORF Clone, Mouse, C-HA tag MG5A7581-CY
SLC25A3 cDNA ORF Clone, Mouse, C-HA tag MG51799-CY
SLC25A3 cDNA ORF Clone, Mouse, N-HA tag MG5A7581-NY
SLC25A3 cDNA ORF Clone, Mouse, N-HA tag MG51799-NY
SLC25A3 cDNA ORF Clone, Mouse, C-Myc tag MG51799-CM
SLC25A3 cDNA ORF Clone, Mouse, C-Myc tag MG5A7581-CM
SLC25A3 cDNA ORF Clone, Mouse, N-Myc tag MG5A7581-NM
SLC25A3 cDNA ORF Clone, Mouse, N-Myc tag MG51799-NM
SLC25A3 qPCR Primer Pairs, Mouse MP201672

SLC25A3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A3 cDNA ORF Clone in Cloning Vector, Human HG16337-G
SLC25A3 cDNA ORF Clone, Human, untagged HG16337-UT
SLC25A3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16337-ACG
SLC25A3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16337-ACGLN
SLC25A3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16337-ANG
SLC25A3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16337-ACR
SLC25A3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16337-ANR
SLC25A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16337-CF
SLC25A3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16337-NF
SLC25A3 cDNA ORF Clone, Human, C-His tag HG16337-CH
SLC25A3 cDNA ORF Clone, Human, N-His tag HG16337-NH
SLC25A3 cDNA ORF Clone, Human, C-HA tag HG16337-CY
SLC25A3 cDNA ORF Clone, Human, N-HA tag HG16337-NY
SLC25A3 cDNA ORF Clone, Human, C-Myc tag HG16337-CM
SLC25A3 cDNA ORF Clone, Human, N-Myc tag HG16337-NM
SLC25A3 qPCR Primer Pairs, Human HP105090
info info
添加购物车成功! 添加购物车失败!