SLC25A19 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52719-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A19 Reagents
CRO Services
Product recommended

All SLC25A19 Reagents
SLC25A19 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Mouse solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A19 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2900089E13Rik cDNA ORF Clone, Mouse;DNC cDNA ORF Clone, Mouse;MUP1 cDNA ORF Clone, Mouse;TPC cDNA ORF Clone, Mouse
SLC25A19 Background Information
Full Name
solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19

SLC25A19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A19 cDNA ORF Clone in Cloning Vector, Mouse MG52719-U
SLC25A19 cDNA ORF Clone, Mouse, untagged MG52719-UT
SLC25A19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52719-ACGLN
SLC25A19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52719-ACG
SLC25A19 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52719-ANG
SLC25A19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52719-ACR
SLC25A19 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52719-ANR
SLC25A19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52719-CF
SLC25A19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52719-NF
SLC25A19 cDNA ORF Clone, Mouse, C-His tag MG52719-CH
SLC25A19 cDNA ORF Clone, Mouse, N-His tag MG52719-NH
SLC25A19 cDNA ORF Clone, Mouse, C-HA tag MG52719-CY
SLC25A19 cDNA ORF Clone, Mouse, N-HA tag MG52719-NY
SLC25A19 cDNA ORF Clone, Mouse, C-Myc tag MG52719-CM
SLC25A19 qPCR Primer Pairs, Mouse MP202590

SLC25A19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A19 cDNA ORF Clone in Cloning Vector, Human HG16402-G
SLC25A19 cDNA ORF Clone, Human, untagged HG16402-UT
SLC25A19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16402-ACGLN
SLC25A19 cDNA ORF Clone, Human, C-GFPSpark® tag HG16402-ACG
SLC25A19 cDNA ORF Clone, Human, N-GFPSpark® tag HG16402-ANG
SLC25A19 cDNA ORF Clone, Human, C-OFPSpark® tag HG16402-ACR
SLC25A19 cDNA ORF Clone, Human, N-OFPSpark® tag HG16402-ANR
SLC25A19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16402-CF
SLC25A19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16402-NF
SLC25A19 cDNA ORF Clone, Human, C-His tag HG16402-CH
SLC25A19 cDNA ORF Clone, Human, N-His tag HG16402-NH
SLC25A19 cDNA ORF Clone, Human, C-HA tag HG16402-CY
SLC25A19 cDNA ORF Clone, Human, N-HA tag HG16402-NY
SLC25A19 cDNA ORF Clone, Human, C-Myc tag HG16402-CM
SLC25A19 cDNA ORF Clone, Human, N-Myc tag HG16402-NM
SLC25A19 qPCR Primer Pairs, Human HP105151
info info
添加购物车成功! 添加购物车失败!