SLC25A17 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51585-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A17 Reagents
CRO Services
Product recommended

All SLC25A17 Reagents
SLC25A17 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
924 bp
Description
Full length Clone DNA of Mouse solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A17 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
34kDa cDNA ORF Clone, Mouse;47kDa cDNA ORF Clone, Mouse;PMP34 cDNA ORF Clone, Mouse;Pmp47 cDNA ORF Clone, Mouse
SLC25A17 Background Information
Full Name
solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17

SLC25A17 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SLC25A17 cDNA ORF Clone in Cloning Vector, Canine DG70253-U
SLC25A17 cDNA ORF Clone, Canine, untagged DG70253-UT
SLC25A17 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70253-ACG
SLC25A17 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70253-ACGLN
SLC25A17 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70253-ACR
SLC25A17 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70253-CF
SLC25A17 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70253-NF
SLC25A17 cDNA ORF Clone, Canine, C-His tag DG70253-CH
SLC25A17 cDNA ORF Clone, Canine, N-His tag DG70253-NH
SLC25A17 cDNA ORF Clone, Canine, C-HA tag DG70253-CY
SLC25A17 cDNA ORF Clone, Canine, N-HA tag DG70253-NY
SLC25A17 cDNA ORF Clone, Canine, C-Myc tag DG70253-CM
SLC25A17 cDNA ORF Clone, Canine, N-Myc tag DG70253-NM

SLC25A17 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC25A17 cDNA ORF Clone in Cloning Vector, Rat RG80904-U
SLC25A17 cDNA ORF Clone, Rat, untagged RG80904-UT
SLC25A17 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80904-ACGLN
SLC25A17 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80904-ACG
SLC25A17 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80904-ACR
SLC25A17 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80904-CF
SLC25A17 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80904-NF
SLC25A17 cDNA ORF Clone, Rat, C-His tag RG80904-CH
SLC25A17 cDNA ORF Clone, Rat, N-His tag RG80904-NH
SLC25A17 cDNA ORF Clone, Rat, C-HA tag RG80904-CY
SLC25A17 cDNA ORF Clone, Rat, N-HA tag RG80904-NY
SLC25A17 cDNA ORF Clone, Rat, C-Myc tag RG80904-CM
SLC25A17 cDNA ORF Clone, Rat, N-Myc tag RG80904-NM
SLC25A17 qPCR Primer Pairs, Rat RP300868

SLC25A17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A17 cDNA ORF Clone in Cloning Vector, Mouse MG51585-G
SLC25A17 cDNA ORF Clone, Mouse, untagged MG51585-UT
SLC25A17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51585-ACG
SLC25A17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51585-ACGLN
SLC25A17 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51585-ANG
SLC25A17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51585-ACR
SLC25A17 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51585-ANR
SLC25A17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51585-CF
SLC25A17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51585-NF
SLC25A17 cDNA ORF Clone, Mouse, C-His tag MG51585-CH
SLC25A17 cDNA ORF Clone, Mouse, N-His tag MG51585-NH
SLC25A17 cDNA ORF Clone, Mouse, C-HA tag MG51585-CY
SLC25A17 cDNA ORF Clone, Mouse, N-HA tag MG51585-NY
SLC25A17 cDNA ORF Clone, Mouse, C-Myc tag MG51585-CM
SLC25A17 qPCR Primer Pairs, Mouse MP201468
info info
添加购物车成功! 添加购物车失败!