SLC25A11 cDNA ORF Clone, Mouse, untagged

Cat: MG51650-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A11 Reagents
CRO Services
Product recommended

All SLC25A11 Reagents
SLC25A11 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
945 bp
Description
Full length Clone DNA of Mouse solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A11 cDNA ORF Clone, Mouse, untagged Alternative Names
2310022P18Rik cDNA ORF Clone, Mouse;2oxoc cDNA ORF Clone, Mouse
SLC25A11 Background Information
Full Name
solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11

SLC25A11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A11 cDNA ORF Clone in Cloning Vector, Mouse MG51650-G
SLC25A11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51650-ACG
SLC25A11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51650-ACGLN
SLC25A11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51650-ANG
SLC25A11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51650-ACR
SLC25A11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51650-ANR
SLC25A11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51650-CF
SLC25A11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51650-NF
SLC25A11 cDNA ORF Clone, Mouse, C-His tag MG51650-CH
SLC25A11 cDNA ORF Clone, Mouse, N-His tag MG51650-NH
SLC25A11 cDNA ORF Clone, Mouse, C-HA tag MG51650-CY
SLC25A11 cDNA ORF Clone, Mouse, N-HA tag MG51650-NY
SLC25A11 cDNA ORF Clone, Mouse, C-Myc tag MG51650-CM
SLC25A11 cDNA ORF Clone, Mouse, N-Myc tag MG51650-NM
SLC25A11 qPCR Primer Pairs, Mouse MP201523

SLC25A11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A11 cDNA ORF Clone in Cloning Vector, Human HG16162-G
SLC25A11 cDNA ORF Clone, Human, untagged HG16162-UT
SLC25A11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16162-ACGLN
SLC25A11 cDNA ORF Clone, Human, C-GFPSpark® tag HG16162-ACG
SLC25A11 cDNA ORF Clone, Human, N-GFPSpark® tag HG16162-ANG
SLC25A11 cDNA ORF Clone, Human, C-OFPSpark® tag HG16162-ACR
SLC25A11 cDNA ORF Clone, Human, N-OFPSpark® tag HG16162-ANR
SLC25A11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16162-CF
SLC25A11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16162-NF
SLC25A11 cDNA ORF Clone, Human, C-His tag HG16162-CH
SLC25A11 cDNA ORF Clone, Human, N-His tag HG16162-NH
SLC25A11 cDNA ORF Clone, Human, C-HA tag HG16162-CY
SLC25A11 cDNA ORF Clone, Human, N-HA tag HG16162-NY
SLC25A11 cDNA ORF Clone, Human, C-Myc tag HG16162-CM
SLC25A11 cDNA ORF Clone, Human, N-Myc tag HG16162-NM
SLC25A11 qPCR Primer Pairs, Human HP104931
info info
添加购物车成功! 添加购物车失败!