SLA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG53043-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SLA Reagents
CRO Services
Product recommended

All SLA Reagents
SLA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
522 bp
Description
Full length Clone DNA of Mouse src-like adaptor with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
Slap cDNA ORF Clone, Mouse;Slap-1 cDNA ORF Clone, Mouse
SLA Background Information
Full Name
Src-like-adaptor

SLA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLA cDNA ORF Clone in Cloning Vector, Mouse MG53043-G
SLA cDNA ORF Clone, Mouse, untagged MG53043-UT
SLA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53043-ACG
SLA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53043-ACGLN
SLA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53043-ANG
SLA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53043-ACR
SLA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53043-ANR
SLA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53043-CF
SLA cDNA ORF Clone, Mouse, C-His tag MG53043-CH
SLA cDNA ORF Clone, Mouse, N-His tag MG53043-NH
SLA cDNA ORF Clone, Mouse, C-HA tag MG53043-CY
SLA cDNA ORF Clone, Mouse, N-HA tag MG53043-NY
SLA cDNA ORF Clone, Mouse, C-Myc tag MG53043-CM
SLA cDNA ORF Clone, Mouse, N-Myc tag MG53043-NM

SLA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLA cDNA ORF Clone in Cloning Vector, Human HG12748-U
SLA cDNA ORF Clone, Human, untagged HG12748-UT
SLA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12748-ACGLN
SLA cDNA ORF Clone, Human, C-GFPSpark® tag HG12748-ACG
SLA cDNA ORF Clone, Human, N-GFPSpark® tag HG12748-ANG
SLA cDNA ORF Clone, Human, C-OFPSpark® tag HG12748-ACR
SLA cDNA ORF Clone, Human, N-OFPSpark® tag HG12748-ANR
SLA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12748-CF
SLA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12748-NF
SLA cDNA ORF Clone, Human, C-His tag HG12748-CH
SLA cDNA ORF Clone, Human, N-His tag HG12748-NH
SLA cDNA ORF Clone, Human, C-HA tag HG12748-CY
SLA cDNA ORF Clone, Human, N-HA tag HG12748-NY
SLA cDNA ORF Clone, Human, C-Myc tag HG12748-CM
SLA cDNA ORF Clone, Human, N-Myc tag HG12748-NM
info info
添加购物车成功! 添加购物车失败!