Quick Order

Text Size:AAA

Mouse SIRT5 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse SIRT5 cDNA Clone Product Information
NCBI RefSeq:NM_178848.3
RefSeq ORF Size:933bp
cDNA Description:Full length Clone DNA of Mus musculus sirtuin 5 (silent mating type information regulation 2 homolog) 5 (S. cerevisiae) with C terminal His tag.
Gene Synonym:AV001953, 0610012J09Rik, 1500032M05Rik, Sirt5
Species:Mouse
Vector:pCMV3-C-His
Plasmid:pCMV3-mSIRT5-His
Restriction Site:KpnI + XbaI (6kb + 0.98kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 A>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SIRT5 Gene Plasmid Map
Mouse SIRT5 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: MG50483-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Mouse SIRT5 natural ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"