SIRT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50566-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SIRT2 Reagents
CRO Services
Product recommended

All SIRT2 Reagents
SIRT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1059 bp
Description
Full length Clone DNA of Mouse sirtuin 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIRT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
5730427M03Rik cDNA ORF Clone, Mouse;Sir2l cDNA ORF Clone, Mouse;SIR2L2 cDNA ORF Clone, Mouse
SIRT2 Background Information
Full Name
sirtuin 2

SIRT2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
SIRT2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90540-G
SIRT2 cDNA ORF Clone, Cynomolgus, untagged CG90540-UT
SIRT2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90540-ACGLN
SIRT2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90540-ACG
SIRT2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90540-ANG
SIRT2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90540-ACR
SIRT2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90540-ANR
SIRT2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90540-CF
SIRT2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90540-NF
SIRT2 cDNA ORF Clone, Cynomolgus, C-His tag CG90540-CH
SIRT2 cDNA ORF Clone, Cynomolgus, N-His tag CG90540-NH
SIRT2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90540-CY
SIRT2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90540-NY
SIRT2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90540-CM
SIRT2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90540-NM

SIRT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SIRT2 cDNA ORF Clone in Cloning Vector, Rat RG80973-U
SIRT2 cDNA ORF Clone, Rat, untagged RG80973-UT
SIRT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80973-ACG
SIRT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80973-ACGLN
SIRT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80973-ANG
SIRT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80973-ACR
SIRT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80973-ANR
SIRT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80973-CF
SIRT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80973-NF
SIRT2 cDNA ORF Clone, Rat, C-His tag RG80973-CH
SIRT2 cDNA ORF Clone, Rat, N-His tag RG80973-NH
SIRT2 cDNA ORF Clone, Rat, C-HA tag RG80973-CY
SIRT2 cDNA ORF Clone, Rat, N-HA tag RG80973-NY
SIRT2 cDNA ORF Clone, Rat, C-Myc tag RG80973-CM
SIRT2 cDNA ORF Clone, Rat, N-Myc tag RG80973-NM
SIRT2 qPCR Primer Pairs, Rat RP300937

SIRT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SIRT2 cDNA ORF Clone in Cloning Vector, Mouse MG50566-G
SIRT2 cDNA ORF Clone, Mouse, untagged MG50566-UT
SIRT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50566-ACGLN
SIRT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50566-ACG
SIRT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50566-ANG
SIRT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50566-ACR
SIRT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50566-ANR
SIRT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50566-CF
SIRT2 cDNA ORF Clone, Mouse, C-His tag MG50566-CH
SIRT2 cDNA ORF Clone, Mouse, N-His tag MG50566-NH
SIRT2 cDNA ORF Clone, Mouse, C-HA tag MG50566-CY
SIRT2 cDNA ORF Clone, Mouse, N-HA tag MG50566-NY
SIRT2 cDNA ORF Clone, Mouse, C-Myc tag MG50566-CM
SIRT2 cDNA ORF Clone, Mouse, N-Myc tag MG50566-NM
SIRT2 qPCR Primer Pairs, Mouse MP200558

SIRT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SIRT2 cDNA ORF Clone in Cloning Vector, Human HG10830-M
SIRT2 cDNA ORF Clone, Human, untagged HG10830-UT
SIRT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10830-ACG
SIRT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10830-ACGLN
SIRT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10830-ANG
SIRT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10830-ACR
SIRT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10830-ANR
SIRT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10830-CF
SIRT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10830-NF
SIRT2 cDNA ORF Clone, Human, C-His tag HG10830-CH
SIRT2 cDNA ORF Clone, Human, N-His tag HG10830-NH
SIRT2 cDNA ORF Clone, Human, C-HA tag HG10830-CY
SIRT2 cDNA ORF Clone, Human, N-HA tag HG10830-NY
SIRT2 cDNA ORF Clone, Human, C-Myc tag HG10830-CM
SIRT2 cDNA ORF Clone, Human, N-Myc tag HG10830-NM
SIRT2 qPCR Primer Pairs, Human HP100730
info info
添加购物车成功! 添加购物车失败!