SIRP-beta cDNA ORF Clone, Mouse, N-His tag

Cat: MG50816-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SIRP-beta Reagents
CRO Services
Product recommended

All SIRP-beta Reagents
SIRP-beta cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Description
Full length Clone DNA of Mouse signal-regulatory protein beta 1A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIRP-beta cDNA ORF Clone, Mouse, N-His tag Alternative Names
9930027N05Rik cDNA ORF Clone, Mouse;SIRP-beta cDNA ORF Clone, Mouse;Sirpb cDNA ORF Clone, Mouse;Sirpb1 cDNA ORF Clone, Mouse
SIRP-beta Background Information

SIRPB1A (Signal-regulatory protein beta 1A), also known as SIRP beta 1, belongs to signal-regulatory-protein (SIRP) family, and immunoglobulin superfamily. Signal-regulatory proteins (SIRPs) are cell-surface glycoproteins expressed on myeloid and neural cells that have been shown to recruit SH2 domain-containing protein phosphatase 1 (SHP-1) and SHP-2 and to regulate receptor tyrosine kinase-coupled signaling. SIRP are classified as SIRP alpha molecules, containing a 110- to 113-amino acid long, or SIRP beta molecules, with a 5-amino acid long intracytoplasmic domain. SIRP beta 1 is a new DAP12-associated receptor involved in the activation of myeloid cells, which contains a short cytoplasmic domain that lacks sequence motifs capable of recruiting SHP-1 and SHP-2. SIRP beta 1. SIRP beta 1 acts as an activating isoform of SIRP alpha molecules, confirming the co-existence of inhibitory ITIM-bearing molecules, recruiting SHP-1 and SHP-2 protein tyrosine phosphatases, and activating counterparts, whose engagement couples to protein tyrosine kinases via ITAM-bearing molecules.

References
  • Gaikwad S, et al. (2009) Signal regulatory protein-beta1: a microglial modulator of phagocytosis in Alzheimer's disease. Am J Pathol. 175(6): 2528-39.
  • Dietrich J, et al. (2000) Cutting edge: signal-regulatory protein beta 1 is a DAP12-associated activating receptor expressed in myeloid cells. J Immunol. 164(1): 9-12.
  • Tomasello E, et al. (2000) Association of signal-regulatory proteins beta with KARAP/DAP-12. Eur J Immunol. 30(8): 2147-56.
  • info info
    添加购物车成功! 添加购物车失败!