Quick Order

Text Size:AAA

Mouse SIRPB1A ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse SIRP-BETA cDNA Clone Product Information
NCBI RefSeq:AB112024
RefSeq ORF Size:1176bp
cDNA Description:Full length Clone DNA of Mus musculus signal-regulatory protein beta 1A with N terminal Myc tag.
Gene Synonym:Sirpb, Sirpb1, SIRP-beta, 9930027N05Rik, Sirpb1a
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SIRPB1A (Signal-regulatory protein beta 1A), also known as SIRP beta 1, belongs to signal-regulatory-protein (SIRP) family, and immunoglobulin superfamily. Signal-regulatory proteins (SIRPs) are cell-surface glycoproteins expressed on myeloid and neural cells that have been shown to recruit SH2 domain-containing protein phosphatase 1 (SHP-1) and SHP-2 and to regulate receptor tyrosine kinase-coupled signaling. SIRP are classified as SIRP alpha molecules, containing a 110- to 113-amino acid long, or SIRP beta molecules, with a 5-amino acid long intracytoplasmic domain. SIRP beta 1 is a new DAP12-associated receptor involved in the activation of myeloid cells, which contains a short cytoplasmic domain that lacks sequence motifs capable of recruiting SHP-1 and SHP-2. SIRP beta 1. SIRP beta 1 acts as an activating isoform of SIRP alpha molecules, confirming the co-existence of inhibitory ITIM-bearing molecules, recruiting SHP-1 and SHP-2 protein tyrosine phosphatases, and activating counterparts, whose engagement couples to protein tyrosine kinases via ITAM-bearing molecules.

References
  • Gaikwad S, et al. (2009) Signal regulatory protein-beta1: a microglial modulator of phagocytosis in Alzheimer's disease. Am J Pathol. 175(6): 2528-39.
  • Dietrich J, et al. (2000) Cutting edge: signal-regulatory protein beta 1 is a DAP12-associated activating receptor expressed in myeloid cells. J Immunol. 164(1): 9-12.
  • Tomasello E, et al. (2000) Association of signal-regulatory proteins beta with KARAP/DAP-12. Eur J Immunol. 30(8): 2147-56.
  • Size / Price
    Catalog: MG50816-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"