After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SIRPB1A Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse SIRP-BETA cDNA Clone Product Information
NCBI RefSeq:AB112024
RefSeq ORF Size:1176bp
cDNA Description:Full length Clone DNA of Mus musculus signal-regulatory protein beta 1A with N terminal His tag.
Gene Synonym:Sirpb, Sirpb1, SIRP-beta, 9930027N05Rik, Sirpb1a
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

SIRPB1A (Signal-regulatory protein beta 1A), also known as SIRP beta 1, belongs to signal-regulatory-protein (SIRP) family, and immunoglobulin superfamily. Signal-regulatory proteins (SIRPs) are cell-surface glycoproteins expressed on myeloid and neural cells that have been shown to recruit SH2 domain-containing protein phosphatase 1 (SHP-1) and SHP-2 and to regulate receptor tyrosine kinase-coupled signaling. SIRP are classified as SIRP alpha molecules, containing a 110- to 113-amino acid long, or SIRP beta molecules, with a 5-amino acid long intracytoplasmic domain. SIRP beta 1 is a new DAP12-associated receptor involved in the activation of myeloid cells, which contains a short cytoplasmic domain that lacks sequence motifs capable of recruiting SHP-1 and SHP-2. SIRP beta 1. SIRP beta 1 acts as an activating isoform of SIRP alpha molecules, confirming the co-existence of inhibitory ITIM-bearing molecules, recruiting SHP-1 and SHP-2 protein tyrosine phosphatases, and activating counterparts, whose engagement couples to protein tyrosine kinases via ITAM-bearing molecules.

References
  • Gaikwad S, et al. (2009) Signal regulatory protein-beta1: a microglial modulator of phagocytosis in Alzheimer's disease. Am J Pathol. 175(6): 2528-39.
  • Dietrich J, et al. (2000) Cutting edge: signal-regulatory protein beta 1 is a DAP12-associated activating receptor expressed in myeloid cells. J Immunol. 164(1): 9-12.
  • Tomasello E, et al. (2000) Association of signal-regulatory proteins beta with KARAP/DAP-12. Eur J Immunol. 30(8): 2147-56.
  • Size / Price
    Catalog: MG50816-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"