SIAE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG53030-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SIAE Reagents
CRO Services
Product recommended

All SIAE Reagents
SIAE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1626 bp
Description
Full length Clone DNA of Mouse sialic acid acetylesterase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIAE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
LSE cDNA ORF Clone, Mouse;Ysg2 cDNA ORF Clone, Mouse
SIAE Background Information

Sialate O-acetylesterase belongs to the family of hydrolases, specifically those acting on carboxylic ester bonds. It is widely expressed with high expression in the testis, prostate, and colon. The systematic name of this enzyme class is N-acyl-O-acetylneuraminate O-acetylhydrolase. Other names in common use include N-acetylneuraminate acetyltransferase, sialate 9(4)-O-acetylesterase, and sialidase. Sialate O-acetylesterase catalyzes the removal of O-acetyl ester groups from position 9 of the parent sialic acid, N-acetylneuraminic acid. Defects in Sialate O-acetylesterase are a cause of autoimmune disease type 6 (AIS6). Individuals manifesting susceptibility to autoimmune disease type 6 can suffer from juvenile idiopathic arthritis, rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, systemic lupus erythematosus, type 1 diabetes, ulcerative colitis, and Crohn disease.

Full Name
sialic acid acetylesterase
References
  • Mandal C, et al. (2012) Regulation of O-acetylation of sialic acids by sialate-O-acetyltransferase and sialate-O-acetylesterase activities in childhood acute lymphoblastic leukemia. Glycobiology. 22(1): 70-83.
  • Tsai S, et al. (2011) Transcriptional profiling of human placentas from pregnancies complicated by preeclampsia reveals disregulation of sialic acid acetylesterase and immune signalling pathways. Placenta. 32 (2): 175-82.
  • Surolia I, et al. (2010) Functionally defective germline variants of sialic acid acetylesterase in autoimmunity. Nature. 466 (7303): 243-7.
  • SIAE cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SIAE cDNA ORF Clone in Cloning Vector, Mouse MG53030-G
    SIAE cDNA ORF Clone, Mouse, untagged MG53030-UT
    SIAE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53030-ACGLN
    SIAE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53030-ACG
    SIAE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53030-ACR
    SIAE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53030-CF
    SIAE cDNA ORF Clone, Mouse, C-His tag MG53030-CH
    SIAE cDNA ORF Clone, Mouse, N-His tag MG53030-NH
    SIAE cDNA ORF Clone, Mouse, C-HA tag MG53030-CY
    SIAE cDNA ORF Clone, Mouse, N-HA tag MG53030-NY
    SIAE cDNA ORF Clone, Mouse, C-Myc tag MG53030-CM
    SIAE cDNA ORF Clone, Mouse, N-Myc tag MG53030-NM

    SIAE cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SIAE cDNA ORF Clone in Cloning Vector, Human HG13310-G
    SIAE cDNA ORF Clone, Human, untagged HG13310-UT
    SIAE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13310-ACGLN
    SIAE cDNA ORF Clone, Human, C-GFPSpark® tag HG13310-ACG
    SIAE cDNA ORF Clone, Human, C-OFPSpark® tag HG13310-ACR
    SIAE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13310-CF
    SIAE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13310-NF
    SIAE cDNA ORF Clone, Human, C-His tag HG13310-CH
    SIAE cDNA ORF Clone, Human, N-His tag HG13310-NH
    SIAE cDNA ORF Clone, Human, C-HA tag HG13310-CY
    SIAE cDNA ORF Clone, Human, N-HA tag HG13310-NY
    SIAE cDNA ORF Clone, Human, C-Myc tag HG13310-CM
    SIAE cDNA ORF Clone, Human, N-Myc tag HG13310-NM
    SIAE qPCR Primer Pairs, Human HP102016
    info info
    添加购物车成功! 添加购物车失败!