SHISA5 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52973-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SHISA5 Reagents
CRO Services
Product recommended

All SHISA5 Reagents
SHISA5 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
708 bp
Description
Full length Clone DNA of Mouse shisa homolog 5 (Xenopus laevis) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHISA5 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2310008D10Rik cDNA ORF Clone, Mouse;6430628I05Rik cDNA ORF Clone, Mouse;mShisa5 cDNA ORF Clone, Mouse;Scotin cDNA ORF Clone, Mouse
SHISA5 Background Information
Full Name
shisa family member 5

SHISA5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SHISA5 cDNA ORF Clone in Cloning Vector, Mouse MG52973-G
SHISA5 cDNA ORF Clone, Mouse, untagged MG52973-UT
SHISA5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52973-ACGLN
SHISA5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52973-ACG
SHISA5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52973-ANG
SHISA5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52973-ACR
SHISA5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52973-ANR
SHISA5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52973-CF
SHISA5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52973-NF
SHISA5 cDNA ORF Clone, Mouse, C-His tag MG52973-CH
SHISA5 cDNA ORF Clone, Mouse, C-HA tag MG52973-CY
SHISA5 cDNA ORF Clone, Mouse, N-HA tag MG52973-NY
SHISA5 cDNA ORF Clone, Mouse, C-Myc tag MG52973-CM
SHISA5 cDNA ORF Clone, Mouse, N-Myc tag MG52973-NM

SHISA5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SHISA5 cDNA ORF Clone in Cloning Vector, Human HG16850-U
SHISA5 cDNA ORF Clone, Human, untagged HG16850-UT
SHISA5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16850-ACG
SHISA5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16850-ACGLN
SHISA5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16850-ACR
SHISA5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16850-CF
SHISA5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16850-NF
SHISA5 cDNA ORF Clone, Human, C-His tag HG16850-CH
SHISA5 cDNA ORF Clone, Human, N-His tag HG16850-NH
SHISA5 cDNA ORF Clone, Human, C-HA tag HG16850-CY
SHISA5 cDNA ORF Clone, Human, N-HA tag HG16850-NY
SHISA5 cDNA ORF Clone, Human, C-Myc tag HG16850-CM
SHISA5 cDNA ORF Clone, Human, N-Myc tag HG16850-NM
info info
添加购物车成功! 添加购物车失败!