SH3BGRL cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51471-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SH3BGRL Reagents
CRO Services
Product recommended

All SH3BGRL Reagents
SH3BGRL cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
345 bp
Description
Full length Clone DNA of Mouse SH3-binding domain glutamic acid-rich protein like with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SH3BGRL cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1190008F14Rik cDNA ORF Clone, Mouse
SH3BGRL Background Information
Full Name
SH3 domain binding glutamate-rich protein like

SH3BGRL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SH3BGRL cDNA ORF Clone in Cloning Vector, Rat RG89208-U
SH3BGRL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89208-ACGLN

SH3BGRL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SH3BGRL cDNA ORF Clone in Cloning Vector, Mouse MG51471-U
SH3BGRL cDNA ORF Clone, Mouse, untagged MG51471-UT
SH3BGRL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51471-ACGLN
SH3BGRL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51471-ACG
SH3BGRL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51471-ANG
SH3BGRL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51471-ACR
SH3BGRL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51471-ANR
SH3BGRL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51471-CF
SH3BGRL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51471-NF
SH3BGRL cDNA ORF Clone, Mouse, C-His tag MG51471-CH
SH3BGRL cDNA ORF Clone, Mouse, N-His tag MG51471-NH
SH3BGRL cDNA ORF Clone, Mouse, C-HA tag MG51471-CY
SH3BGRL cDNA ORF Clone, Mouse, N-HA tag MG51471-NY
SH3BGRL cDNA ORF Clone, Mouse, C-Myc tag MG51471-CM
SH3BGRL qPCR Primer Pairs, Mouse MP201355

SH3BGRL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SH3BGRL cDNA ORF Clone in Cloning Vector, Human HG16804-U
SH3BGRL cDNA ORF Clone, Human, untagged HG16804-UT
SH3BGRL cDNA ORF Clone, Human, C-GFPSpark® tag HG16804-ACG
SH3BGRL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16804-ACGLN
SH3BGRL cDNA ORF Clone, Human, N-GFPSpark® tag HG16804-ANG
SH3BGRL cDNA ORF Clone, Human, C-OFPSpark® tag HG16804-ACR
SH3BGRL cDNA ORF Clone, Human, N-OFPSpark® tag HG16804-ANR
SH3BGRL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16804-CF
SH3BGRL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16804-NF
SH3BGRL cDNA ORF Clone, Human, C-His tag HG16804-CH
SH3BGRL cDNA ORF Clone, Human, N-His tag HG16804-NH
SH3BGRL cDNA ORF Clone, Human, C-HA tag HG16804-CY
SH3BGRL cDNA ORF Clone, Human, N-HA tag HG16804-NY
SH3BGRL cDNA ORF Clone, Human, C-Myc tag HG16804-CM
SH3BGRL cDNA ORF Clone, Human, N-Myc tag HG16804-NM
info info
添加购物车成功! 添加购物车失败!