SGMS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51982-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SGMS1 Reagents
CRO Services
Product recommended

All SGMS1 Reagents
SGMS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1260 bp
Description
Full length Clone DNA of Mouse sphingomyelin synthase 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SGMS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
9530058O11Rik cDNA ORF Clone, Mouse;AI841905 cDNA ORF Clone, Mouse;C80702 cDNA ORF Clone, Mouse;Mob cDNA ORF Clone, Mouse;Sms1 cDNA ORF Clone, Mouse;Sor1 cDNA ORF Clone, Mouse;Tmem23 cDNA ORF Clone, Mouse
SGMS1 Background Information
Full Name
sphingomyelin synthase 1

SGMS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SGMS1 cDNA ORF Clone in Cloning Vector, Mouse MG51982-G
SGMS1 cDNA ORF Clone, Mouse, untagged MG51982-UT
SGMS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51982-ACG
SGMS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51982-ACGLN
SGMS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51982-ANG
SGMS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51982-ACR
SGMS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51982-ANR
SGMS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51982-CF
SGMS1 cDNA ORF Clone, Mouse, C-His tag MG51982-CH
SGMS1 cDNA ORF Clone, Mouse, N-His tag MG51982-NH
SGMS1 cDNA ORF Clone, Mouse, C-HA tag MG51982-CY
SGMS1 cDNA ORF Clone, Mouse, N-HA tag MG51982-NY
SGMS1 cDNA ORF Clone, Mouse, C-Myc tag MG51982-CM
SGMS1 cDNA ORF Clone, Mouse, N-Myc tag MG51982-NM
SGMS1 qPCR Primer Pairs, Mouse MP201855

SGMS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SGMS1 cDNA ORF Clone in Cloning Vector, Human HG19271-U
SGMS1 cDNA ORF Clone, Human, untagged HG19271-UT
SGMS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19271-ACGLN
SGMS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG19271-ACG
SGMS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG19271-ANG
SGMS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG19271-ACR
SGMS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG19271-ANR
SGMS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19271-CF
SGMS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19271-NF
SGMS1 cDNA ORF Clone, Human, C-His tag HG19271-CH
SGMS1 cDNA ORF Clone, Human, N-His tag HG19271-NH
SGMS1 cDNA ORF Clone, Human, C-HA tag HG19271-CY
SGMS1 cDNA ORF Clone, Human, N-HA tag HG19271-NY
SGMS1 cDNA ORF Clone, Human, C-Myc tag HG19271-CM
SGMS1 cDNA ORF Clone, Human, N-Myc tag HG19271-NM
info info
添加购物车成功! 添加购物车失败!