Quick Order

Mouse SGK1/SGK Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse SGK1 cDNA Clone Product Information
NCBI RefSeq:NM_011361.1
RefSeq ORF Size:1296bp
cDNA Description:Full length Clone DNA of Mus musculus serum/glucocorticoid regulated kinase 1.
Gene Synonym:Sgk, Sgk1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mSGK1
Restriction Site:KpnI + XbaI(6.1kb+1.3kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 600A/C,813G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SGK1 qPCR primers for gene expression analysis, MP200302 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG50278-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"