SFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51670-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SFR1 Reagents
CRO Services
Product recommended

All SFR1 Reagents
SFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
960 bp
Description
Full length Clone DNA of Mouse SWI5 dependent recombination repair 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
6330577E15Rik cDNA ORF Clone, Mouse;Meir5 cDNA ORF Clone, Mouse
SFR1 Background Information
Full Name
SWI5-dependent homologous recombination repair protein 1

SFR1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SFR1 cDNA ORF Clone in Cloning Vector, Rat RG80963-U
SFR1 cDNA ORF Clone, Rat, untagged RG80963-UT
SFR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80963-ACGLN
SFR1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80963-ACG
SFR1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80963-ANG
SFR1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80963-ACR
SFR1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80963-ANR
SFR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80963-CF
SFR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80963-NF
SFR1 cDNA ORF Clone, Rat, C-His tag RG80963-CH
SFR1 cDNA ORF Clone, Rat, N-His tag RG80963-NH
SFR1 cDNA ORF Clone, Rat, C-HA tag RG80963-CY
SFR1 cDNA ORF Clone, Rat, N-HA tag RG80963-NY
SFR1 cDNA ORF Clone, Rat, C-Myc tag RG80963-CM
SFR1 cDNA ORF Clone, Rat, N-Myc tag RG80963-NM
SFR1 qPCR Primer Pairs, Rat RP300927

SFR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SFR1 cDNA ORF Clone in Cloning Vector, Mouse MG51670-G
SFR1 cDNA ORF Clone, Mouse, untagged MG51670-UT
SFR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51670-ACG
SFR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51670-ACGLN
SFR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51670-ANG
SFR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51670-ACR
SFR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51670-ANR
SFR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51670-NF
SFR1 cDNA ORF Clone, Mouse, C-His tag MG51670-CH
SFR1 cDNA ORF Clone, Mouse, N-His tag MG51670-NH
SFR1 cDNA ORF Clone, Mouse, C-HA tag MG51670-CY
SFR1 cDNA ORF Clone, Mouse, N-HA tag MG51670-NY
SFR1 cDNA ORF Clone, Mouse, C-Myc tag MG51670-CM
SFR1 cDNA ORF Clone, Mouse, N-Myc tag MG51670-NM
SFR1 qPCR Primer Pairs, Mouse MP201543
info info
添加购物车成功! 添加购物车失败!