PEDF cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50235-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PEDF Reagents
CRO Services
Product recommended

All PEDF Reagents
PEDF cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade F, member 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PEDF cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI195227 cDNA ORF Clone, Mouse;EPC-1 cDNA ORF Clone, Mouse;Pedf cDNA ORF Clone, Mouse;Pedfl cDNA ORF Clone, Mouse;Sdf3 cDNA ORF Clone, Mouse
PEDF Background Information

Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

Full Name
serpin peptidase inhibitor, clade F,member 1
References
  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.
  • PEDF cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PEDF cDNA ORF Clone in Cloning Vector, Rat RG80481-U
    PEDF cDNA ORF Clone, Rat, untagged RG80481-UT
    PEDF Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80481-ACGLN
    PEDF cDNA ORF Clone, Rat, C-GFPSpark® tag RG80481-ACG
    PEDF cDNA ORF Clone, Rat, C-OFPSpark® tag RG80481-ACR
    PEDF cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80481-CF
    PEDF cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80481-NF
    PEDF cDNA ORF Clone, Rat, C-His tag RG80481-CH
    PEDF cDNA ORF Clone, Rat, N-His tag RG80481-NH
    PEDF cDNA ORF Clone, Rat, C-HA tag RG80481-CY
    PEDF cDNA ORF Clone, Rat, N-HA tag RG80481-NY
    PEDF cDNA ORF Clone, Rat, C-Myc tag RG80481-CM
    PEDF cDNA ORF Clone, Rat, N-Myc tag RG80481-NM
    PEDF qPCR Primer Pairs, Rat RP300445

    PEDF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PEDF cDNA ORF Clone in Cloning Vector, Mouse MG50235-M
    PEDF cDNA ORF Clone, Mouse, untagged MG50235-UT
    PEDF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50235-ACGLN
    PEDF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50235-ACG
    PEDF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50235-ACR
    PEDF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50235-CF
    PEDF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50235-NF
    PEDF cDNA ORF Clone, Mouse, C-His tag MG50235-CH
    PEDF cDNA ORF Clone, Mouse, N-His tag MG50235-NH
    PEDF cDNA ORF Clone, Mouse, C-HA tag MG50235-CY
    PEDF cDNA ORF Clone, Mouse, N-HA tag MG50235-NY
    PEDF cDNA ORF Clone, Mouse, C-Myc tag MG50235-CM
    PEDF qPCR Primer Pairs, Mouse MP200261

    PEDF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PEDF cDNA ORF Clone in Cloning Vector, Human HG11104-M
    PEDF cDNA ORF Clone, Human, untagged HG11104-UT
    PEDF cDNA ORF Clone, Human, C-GFPSpark® tag HG11104-ACG
    PEDF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11104-ACGLN
    PEDF cDNA ORF Clone, Human, C-OFPSpark® tag HG11104-ACR
    PEDF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11104-CF
    PEDF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11104-NF
    PEDF cDNA ORF Clone, Human, C-His tag HG11104-CH
    PEDF cDNA ORF Clone, Human, N-His tag HG11104-NH
    PEDF cDNA ORF Clone, Human, C-HA tag HG11104-CY
    PEDF cDNA ORF Clone, Human, N-HA tag HG11104-NY
    PEDF cDNA ORF Clone, Human, C-Myc tag HG11104-CM
    PEDF cDNA ORF Clone, Human, N-Myc tag HG11104-NM
    PEDF qPCR Primer Pairs, Human HP101019
    info info
    添加购物车成功! 添加购物车失败!