Quick Order

Mouse SERPINB9 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse SERPINB9 cDNA Clone Product Information
NCBI RefSeq:NM_009256.3
RefSeq ORF Size:1125bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 9 with C terminal Myc tag.
Gene Synonym:PI9, CAP3, PI-9, Spi6, CAP-3, BB283241, ovalbumin, Serpinb9
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SerpinB9, also known as Cytoplasmic antiproteinase 3, CAP-3, Peptidase inhibitor 9, SERPINB9 and PI-9, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. Serpin-B9 ( CAP-3 / PI-9 ) is the only known human intracellular inhibitor of granzyme B (GrB), the effector molecule in immunity against cytomegalovirus (CMV) and in renal allograft rejection. Serpin-B9 and SPI-6 expression in immune-privileged cells, APCs, and CTLs protects these cells against the actions of granzyme B, and when expressed in tumor cells or virally infected hepatocytes, confers resistance to killing by CTL and NK cells. Expression of increasing levels of Serpin-B9 ( CAP-3 / PI-9 ) in target cells may progressively inhibit immune surveillance by blocking NK and CTL-induced cytotoxicity through the perforin / granzyme pathway and then through the Fas / FasL pathway. Serpin-B9 ( CAP-3 / PI-9 ) is selectively up-regulated in hepatocytes in response to infiltration of the liver by NK cells that express perforin and enzymatically active granzyme B. Upregulated expression of Serpin-B9 ( CAP-3 / PI-9 ) in NSCLC cells may serve to protect them from apoptosis induced by GrB.

References
  • Rowshani,A.T. et al., 2005, J Infect Dis.192 (11): 1908-11.
  • Cunningham,T.D. et al., 2007, Cell Immunol 245 (1): 32-41.
  • Rousalova,I. et al., 2010, Int J Oncol  36 (1): 275-83.
  • Stout-Delgado,H.W. et al., 2007, J Immunol. 179 (10):6561-7.
  • Size / Price
    Catalog: MG50563-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"