After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse SERPINB9 ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse SERPINB9 cDNA Clone Product Information
NCBI RefSeq:NM_009256.3
RefSeq ORF Size:1125bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 9 with C terminal Flag tag.
Gene Synonym:PI9, CAP3, PI-9, Spi6, CAP-3, BB283241, ovalbumin, Serpinb9
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SerpinB9, also known as Cytoplasmic antiproteinase 3, CAP-3, Peptidase inhibitor 9, SERPINB9 and PI-9, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. Serpin-B9 ( CAP-3 / PI-9 ) is the only known human intracellular inhibitor of granzyme B (GrB), the effector molecule in immunity against cytomegalovirus (CMV) and in renal allograft rejection. Serpin-B9 and SPI-6 expression in immune-privileged cells, APCs, and CTLs protects these cells against the actions of granzyme B, and when expressed in tumor cells or virally infected hepatocytes, confers resistance to killing by CTL and NK cells. Expression of increasing levels of Serpin-B9 ( CAP-3 / PI-9 ) in target cells may progressively inhibit immune surveillance by blocking NK and CTL-induced cytotoxicity through the perforin / granzyme pathway and then through the Fas / FasL pathway. Serpin-B9 ( CAP-3 / PI-9 ) is selectively up-regulated in hepatocytes in response to infiltration of the liver by NK cells that express perforin and enzymatically active granzyme B. Upregulated expression of Serpin-B9 ( CAP-3 / PI-9 ) in NSCLC cells may serve to protect them from apoptosis induced by GrB.

References
  • Rowshani,A.T. et al., 2005, J Infect Dis.192 (11): 1908-11.
  • Cunningham,T.D. et al., 2007, Cell Immunol 245 (1): 32-41.
  • Rousalova,I. et al., 2010, Int J Oncol  36 (1): 275-83.
  • Stout-Delgado,H.W. et al., 2007, J Immunol. 179 (10):6561-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"