Quick Order

Mouse Serpinb6b Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse SERPINB6B cDNA Clone Product Information
NCBI RefSeq:NM_011454.1
RefSeq ORF Size:1134bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6b.
Gene Synonym:NK13, Spi12, ovalbumin, Serpinb6b
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Morgenstern KA, et al. (1994) Complementary DNA cloning and kinetic characterization of a novel intracellular serine proteinase inhibitor: mechanism of action with trypsin and factor Xa as model proteinases. Biochemistry. 33(11): 3432-41.
  • Strik MC, et al. (2004) Intracellular serpin SERPINB6 (PI6) is abundantly expressed by human mast cells and forms complexes with beta-tryptase monomers. Blood.103(7): 2710-7.
  • Scott FL, et al. (2007) SerpinB6 is an inhibitor of kallikrein-8 in keratinocytes. J Biochem. 142(4): 435-42.
  • Size / Price
    Catalog: MG50371-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"