SerpinB5 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50562-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SerpinB5 Reagents
CRO Services
Product recommended

All SerpinB5 Reagents
SerpinB5 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1128 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B, member 5 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SerpinB5 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1110036M19Rik cDNA ORF Clone, Mouse;AI462524 cDNA ORF Clone, Mouse;AI646751 cDNA ORF Clone, Mouse;Maspin cDNA ORF Clone, Mouse;ovalbumin cDNA ORF Clone, Mouse;PI-5 cDNA ORF Clone, Mouse;Spi7 cDNA ORF Clone, Mouse
SerpinB5 Background Information
Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 5

SerpinB5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SerpinB5 cDNA ORF Clone in Cloning Vector, Rat RG81287-U
SerpinB5 cDNA ORF Clone, Rat, untagged RG81287-UT
SerpinB5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81287-ACGLN
SerpinB5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81287-ACG
SerpinB5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81287-ACR
SerpinB5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81287-CF
SerpinB5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81287-NF
SerpinB5 cDNA ORF Clone, Rat, C-His tag RG81287-CH
SerpinB5 cDNA ORF Clone, Rat, N-His tag RG81287-NH
SerpinB5 cDNA ORF Clone, Rat, C-HA tag RG81287-CY
SerpinB5 cDNA ORF Clone, Rat, N-HA tag RG81287-NY
SerpinB5 cDNA ORF Clone, Rat, C-Myc tag RG81287-CM
SerpinB5 cDNA ORF Clone, Rat, N-Myc tag RG81287-NM
SerpinB5 qPCR Primer Pairs, Rat RP301243

SerpinB5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SerpinB5 cDNA ORF Clone in Cloning Vector, Mouse MG50562-M
SerpinB5 cDNA ORF Clone, Mouse, untagged MG50562-UT
SerpinB5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50562-ACG
SerpinB5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50562-ACGLN
SerpinB5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50562-ACR
SerpinB5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50562-CF
SerpinB5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50562-NF
SerpinB5 cDNA ORF Clone, Mouse, C-His tag MG50562-CH
SerpinB5 cDNA ORF Clone, Mouse, N-His tag MG50562-NH
SerpinB5 cDNA ORF Clone, Mouse, C-HA tag MG50562-CY
SerpinB5 cDNA ORF Clone, Mouse, C-Myc tag MG50562-CM
SerpinB5 cDNA ORF Clone, Mouse, N-Myc tag MG50562-NM
SerpinB5 qPCR Primer Pairs, Mouse MP200554

SerpinB5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SerpinB5 cDNA ORF Clone in Cloning Vector, Human HG17565-U
SerpinB5 cDNA ORF Clone, Human, untagged HG17565-UT
SerpinB5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17565-ACGLN
info info
添加购物车成功! 添加购物车失败!