Serpinb3c cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50625-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Serpinb3c Reagents
CRO Services
Product recommended

All Serpinb3c Reagents
Serpinb3c cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1161 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B, member 3C with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Serpinb3c cDNA ORF Clone, Mouse, C-HA tag Alternative Names
1110001H02Rik cDNA ORF Clone, Mouse;1110013A16Rik cDNA ORF Clone, Mouse;Scca2 cDNA ORF Clone, Mouse;Serpinb3c cDNA ORF Clone, Mouse;Serpinb4 cDNA ORF Clone, Mouse
Serpinb3c Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Mouse SerpinB3, also known as Squamous cell carcinoma antigen 1, SCCA-1, SERPINB3, SCCA and SCCA1, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB3 may act as a protease inhibitor to modulate the host immune response against tumor cells. Mouse SerpinB3a and SerpinB3b, but not Serpinb3c, are functional, inhibiting both serine and cysteine proteinases with different inhibitory profiles due to the difference of two amino acids in their reactive site loops. SerpinB3a is ubiquitously expressed in most tissues, whereas expression of SerpinB3b is limited to keratinocytes. SerpinB3a and SerpinB3b may play different roles by inhibiting intrinsic or extrinsic proteinases with different expression distributions and different inhibitory profiles.

Full Name
serine (or cysteine) peptidase inhibitor, clade B, member 3C
References
  • Sakata,Y. et al., 2004, Biochem Biophys Res Commun.324 (4):1340-5.
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30. 
  • info info
    添加购物车成功! 添加购物车失败!