SerpinB12 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50565-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SerpinB12 Reagents
CRO Services
Product recommended

All SerpinB12 Reagents
SerpinB12 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 12 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SerpinB12 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2300003F07Rik cDNA ORF Clone, Mouse;4833409F13Rik cDNA ORF Clone, Mouse
SerpinB12 Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Most serpins are secreted and attain physiologic concentrations in the blood and extracellular fluids. Mouse SerpinB12 is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. It is expressed in many tissues, including brain, bone marrow, lymph node, heart, lung, liver, pancreas, testis, ovary, and intestine. SerpinB12 inhibits trypsin and plasmin, but not thrombin, coagulation factor Xa, or urokinase-type plasminogen activator.

Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 12
References
  • Askew,Y.S. et al., 2001, J Biol Chem. 276 (52):49320-30.
  • Rawlings, ND. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, PJ. et al., 2009, Pancreas. 38 (4): 461-7.
  • SerpinB12 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SerpinB12 cDNA ORF Clone in Cloning Vector, Rat RG81216-U
    SerpinB12 cDNA ORF Clone, Rat, untagged RG81216-UT
    SerpinB12 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81216-ACG
    SerpinB12 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81216-ACGLN
    SerpinB12 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81216-ANG
    SerpinB12 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81216-ACR
    SerpinB12 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81216-ANR
    SerpinB12 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81216-CF
    SerpinB12 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81216-NF
    SerpinB12 cDNA ORF Clone, Rat, C-His tag RG81216-CH
    SerpinB12 cDNA ORF Clone, Rat, N-His tag RG81216-NH
    SerpinB12 cDNA ORF Clone, Rat, C-HA tag RG81216-CY
    SerpinB12 cDNA ORF Clone, Rat, N-HA tag RG81216-NY
    SerpinB12 cDNA ORF Clone, Rat, C-Myc tag RG81216-CM
    SerpinB12 cDNA ORF Clone, Rat, N-Myc tag RG81216-NM
    SerpinB12 qPCR Primer Pairs, Rat RP301172

    SerpinB12 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SerpinB12 cDNA ORF Clone in Cloning Vector, Mouse MG50565-M
    SerpinB12 cDNA ORF Clone, Mouse, untagged MG50565-UT
    SerpinB12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50565-ACGLN
    SerpinB12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50565-ACG
    SerpinB12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50565-ANG
    SerpinB12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50565-ACR
    SerpinB12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50565-ANR
    SerpinB12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50565-CF
    SerpinB12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50565-NF
    SerpinB12 cDNA ORF Clone, Mouse, C-His tag MG50565-CH
    SerpinB12 cDNA ORF Clone, Mouse, N-His tag MG50565-NH
    SerpinB12 cDNA ORF Clone, Mouse, C-HA tag MG50565-CY
    SerpinB12 cDNA ORF Clone, Mouse, N-HA tag MG50565-NY
    SerpinB12 cDNA ORF Clone, Mouse, N-Myc tag MG50565-NM
    SerpinB12 qPCR Primer Pairs, Mouse MP200557
    info info
    添加购物车成功! 添加购物车失败!