Quick Order

Text Size:AAA

Mouse SerpinB12 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse SERPINB12 cDNA Clone Product Information
NCBI RefSeq:NM_027971.2
RefSeq ORF Size:1272bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 12 with N terminal Flag tag.
Gene Synonym:2300003F07Rik, 4833409F13Rik, Serpinb12
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Most serpins are secreted and attain physiologic concentrations in the blood and extracellular fluids. Mouse SerpinB12 is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. It is expressed in many tissues, including brain, bone marrow, lymph node, heart, lung, liver, pancreas, testis, ovary, and intestine. SerpinB12 inhibits trypsin and plasmin, but not thrombin, coagulation factor Xa, or urokinase-type plasminogen activator.

References
  • Askew,Y.S. et al., 2001, J Biol Chem. 276 (52):49320-30.
  • Rawlings, ND. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, PJ. et al., 2009, Pancreas. 38 (4): 461-7.
  • Size / Price
    Catalog: MG50565-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"