Quick Order

Text Size:AAA

Mouse SerpinB12 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse SERPINB12 cDNA Clone Product Information
NCBI RefSeq:NM_027971.2
RefSeq ORF Size:1272bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 12 with C terminal His tag.
Gene Synonym:2300003F07Rik, 4833409F13Rik, Serpinb12
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Most serpins are secreted and attain physiologic concentrations in the blood and extracellular fluids. Mouse SerpinB12 is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. It is expressed in many tissues, including brain, bone marrow, lymph node, heart, lung, liver, pancreas, testis, ovary, and intestine. SerpinB12 inhibits trypsin and plasmin, but not thrombin, coagulation factor Xa, or urokinase-type plasminogen activator.

References
  • Askew,Y.S. et al., 2001, J Biol Chem. 276 (52):49320-30.
  • Rawlings, ND. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, PJ. et al., 2009, Pancreas. 38 (4): 461-7.
  • Size / Price
    Catalog: MG50565-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"