After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SERPINA7 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse SERPINA7 cDNA Clone Product Information
NCBI RefSeq:NM_177920.4
RefSeq ORF Size:1257bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7.
Gene Synonym:TBG, C730040N12Rik, Serpina7
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Thyroxine-binding globulin, also known as T4-binding globulin, Serpin A7 and TBG, is a secreted protein which belongs to the serpin family. TBG is synthesized primarily in the liver as a 54 kDa protein.TBG is genomically a serpin, although it has no inhibitory function like many other members of this class of proteins. TBG binds thyroid hormone in circulation. It is one of three proteins (along with transthyretin and albumin) responsible for carrying the thyroid hormones thyroxine (T4) and 3,5,3’-triiodothyronine (T3) in the bloodstream. Of these three proteins, TBG has the highest affinity for T4 and T3, but is present in the lowest concentration. Despite its low concentration, TBG carries the majority of T4 in serum. Due to the very low serum concentration of T4 and T3, TBG is rarely more than 25% saturated with its ligand. Unlike transthyretin and albumin, TBG has a single binding site for T4/T3. TBG tests are sometimes used in finding the reason for elevated or diminished levels of thyroid hormone.

Size / Price
Catalog: MG50313-UT
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"