CBG cDNA ORF Clone, Mouse, untagged

Cat: MG50314-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CBG Reagents
CRO Services
Product recommended

All CBG Reagents
CBG cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade A, member 6.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CBG cDNA ORF Clone, Mouse, untagged Alternative Names
AI265318 cDNA ORF Clone, Mouse;AV104445 cDNA ORF Clone, Mouse;Cbg cDNA ORF Clone, Mouse
CBG Background Information

Corticosteroid-binding globulin (CBG), also known as SerpinA6, is a non-inhibitory member of the serine proteinase inhibitor (serpin) superfamily. It is the high-affinity transport protein for glucocorticoids in vertebrate blood. CBG is specifically cleaved by this protease at a precise site close to its carboxy-terminus. This induces a conformation change and disrupts the binding between glucocorticoids and CBG, and promotes a significant and local release of glucocorticoids (over 90% of them are bound to CBG in human plasma). In this context, CBG directs glucocorticoids to sites of inflammation, and plays in consequence a crucial role in efficient glucocorticoid action in physiology. The SerpinA6 protein is mainly secreted by the liver. This negative acute phase protein regulates free cortisol levels in the blood and distributes cortisol to its target tissues. SerpinA6 deficiency is an extremely rare hereditary disorder characterized by reduced corticosteroid-binding capacity with normal or low plasma corticosteroid-binding globulin concentration, and normal or low basal cortisol levels associated with hypo-/hypertension and muscle fatigue. There are three heritable, human CBG gene mutations that can reduce CBG-cortisol binding affinity and/or reduce circulating CBG levels.

Full Name
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
References
  • Seralini GE. (1991) A new role for corticosteroid binding globulin (CBG), member of SERPIN superfamily. C R Seances Soc Biol Fil. 185(6): 500-9.
  • Buss C, et al. (2007) Haploinsufficiency of the SERPINA6 gene is associated with severe muscle fatigue: A de novo mutation in corticosteroid-binding globulin deficiency. J Neural Transm. 114(5): 563-9.
  • Torpy DJ, et al. (2007) Corticosteroid-binding globulin gene polymorphisms: clinical implications and links to idiopathic chronic fatigue disorders. Clin Endocrinol (Oxf). 67(2): 161-7.
  • Braun BC, et al. (2010) Effect of mutations of the human serpin protein corticosteroid-binding globulin on cortisol-binding, thermal and protease sensitivity. J Steroid Biochem Mol Biol. 120(1): 30-7.
  • Lin HY, et al. (2010) Molecular and structural basis of steroid hormone binding and release from corticosteroid-binding globulin. Mol Cell Endocrinol. 316(1): 3-12.
  • CBG cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CBG cDNA ORF Clone in Cloning Vector, Mouse MG50314-M
    CBG cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50314-ACG
    CBG Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50314-ACGLN
    CBG cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50314-ACR
    CBG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50314-CF
    CBG cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50314-NF
    CBG cDNA ORF Clone, Mouse, C-His tag MG50314-CH
    CBG cDNA ORF Clone, Mouse, N-His tag MG50314-NH
    CBG cDNA ORF Clone, Mouse, C-HA tag MG50314-CY
    CBG cDNA ORF Clone, Mouse, N-HA tag MG50314-NY
    CBG cDNA ORF Clone, Mouse, C-Myc tag MG50314-CM
    CBG cDNA ORF Clone, Mouse, N-Myc tag MG50314-NM
    CBG qPCR Primer Pairs, Mouse MP200337

    CBG cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CBG cDNA ORF Clone in Cloning Vector, Human HG10998-M
    CBG cDNA ORF Clone, Human, untagged HG10998-UT
    CBG Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10998-ACGLN
    CBG cDNA ORF Clone, Human, C-GFPSpark® tag HG10998-ACG
    CBG cDNA ORF Clone, Human, C-OFPSpark® tag HG10998-ACR
    CBG cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10998-CF
    CBG cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10998-NF
    CBG cDNA ORF Clone, Human, C-His tag HG10998-CH
    CBG cDNA ORF Clone, Human, N-His tag HG10998-NH
    CBG cDNA ORF Clone, Human, C-HA tag HG10998-CY
    CBG cDNA ORF Clone, Human, N-HA tag HG10998-NY
    CBG cDNA ORF Clone, Human, C-Myc tag HG10998-CM
    CBG cDNA ORF Clone, Human, N-Myc tag HG10998-NM
    CBG qPCR Primer Pairs, Human HP100960
    info info
    添加购物车成功! 添加购物车失败!